Uneingeschränkter Zugang

Occurrence and seasonal changes in the population of root-knot nematodes on honeybush (Cyclopia sp.)

,  und   
08. Juni 2021

Zitieren
COVER HERUNTERLADEN

Fig. 1

Google Earth image showing the location of the sampling sites in the Western Cape province of South Africa.
Google Earth image showing the location of the sampling sites in the Western Cape province of South Africa.

Fig. 2

Mean population density of root-knot nematode (RKN) and other plant-parasitic nematode (PPN) associated with honeybush cultivation on six sites at Genadendal, Western Cape province of South Africa (2016-2017). Error bars represent standard errors (±SE).
Mean population density of root-knot nematode (RKN) and other plant-parasitic nematode (PPN) associated with honeybush cultivation on six sites at Genadendal, Western Cape province of South Africa (2016-2017). Error bars represent standard errors (±SE).

Fig. 3

Mean population density of root-knot nematode (RKN) associated with honeybush cultivation at six sampling sites in Genadendal, Western Cape province of South Africa (2016-2017). Error bars represent standard errors (±SE).
Mean population density of root-knot nematode (RKN) associated with honeybush cultivation at six sampling sites in Genadendal, Western Cape province of South Africa (2016-2017). Error bars represent standard errors (±SE).

Fig. 4

Seasonal fluctuation and changes in the nematode population during the sampling period of 2016-2017 at the six experimental sites in Genadendal, Western Cape province of South Africa.
Seasonal fluctuation and changes in the nematode population during the sampling period of 2016-2017 at the six experimental sites in Genadendal, Western Cape province of South Africa.

Fig. 5

Symptoms of RKN damage on honeybush roots.
Symptoms of RKN damage on honeybush roots.

Fig. 6

A-B: Healthy flowering honeybush plants. C-D: Nematode damage on honeybush field, showing loss of plant.
A-B: Healthy flowering honeybush plants. C-D: Nematode damage on honeybush field, showing loss of plant.

Fig. 7

Gel pictures obtained from the amplification of DNA products of single J2s of RKN from honeybush plots. a. Meloidogyne javanica (amplified with FJav/Rjav primers) and b. M. hapla (with JMV1/JMV2 & JMV primers).
Gel pictures obtained from the amplification of DNA products of single J2s of RKN from honeybush plots. a. Meloidogyne javanica (amplified with FJav/Rjav primers) and b. M. hapla (with JMV1/JMV2 & JMV primers).

Temperature and rainfall distribution around Genadendal, Western Cape province (2016 – 2017)_

2016
2017
Month Temperature °C (max) Temperature °C (min) Rainfall (mm) Temperature °C (max) Temperature 0C (min) Rainfall (mm)
January 32.37 19.34 0.26 29.89 16.29 1.4
February 30.59 16.82 0.34 30.73 17.48 0.14
March 26.95 16.06 1.11 30.09 15.07 0.09
April 26.08 13.63 0.89 28.79 14.34 0.92
May 24.31 11.22 0.34 25.11 11.79 0.33
June 20.03 8.48 2.05 20.44 7.51 0.82
July 18.68 8.2 2.72 18.96 7.09 0.4
August 21.55 8.83 1.47 17.28 7.55 1.65
September 21.06 9.34 0.77 20.56 8.66 0.58
October 25.74 11.23 0.25 22.1 9.37 0.79
November 28.04 13.99 0.18 24.27 12.5 1.27
December 31.05 16.07 0.19 26.92 14.98 0.27

Primer codes used for identification of Meloidogyne species, sequences and sources_

Species Primer Sequence 5'-3' Source
M. arenaria Far TCGGCGATAGAGGTAAATGAC M. arenaria-specific SCAR
Rar TCGGCGATAGACACTACAAACT Zijlstra et al. (2000)
M. javanica Fjav GGTGCGCGATTGAACTGAGC M. javanica-specific SCAR
Rjav CAGGCCCTTCAGTGGAACTATAC Zijlstra et al. (2000)
M. incognita MI-F GTGAGGATTCAGCTCCCCAG M. incognita-specific SCAR
MI-R ACGAGGAACATACTTCTCCGTCC Meng et al. (2004)
M. hapla JMV1 GGATGGCGTGCTTTCAAC M. hapla-, M. chitwoodi-and
JMV2 TTTCCCCTTATGATGTTTACCC M. fallax-specific IGS-SCAR
JMVhapla AAAAATCCCCTCGAAAAATCCACC Wishart et al. (2002)
Sprache:
Englisch
Zeitrahmen der Veröffentlichung:
4 Hefte pro Jahr
Fachgebiete der Zeitschrift:
Biologie, Zoologie, Ökologie, Biologie, andere, Medizin, Klinische Medizin, Mikrobiologie, Virologie und Infektionsepidemiologie