Multiple Sclerosis (MS) is a chronic inflammatory disease which leads to demyelination and neurodegeneration of the central nervous system(CNS) [1, 2]. The disease generally affects young adults and causes serious neurological disabilities [3, 4]. Focal demyelination, inflammation, scar formation, and various axonal degeneration are involved in the pathology of MS lesions [4, 5, 6]. Axonal degeneration is the main reason for this non-reversible disability in MS patients [7]. While the etiology of MS is not fully understood, environmental, genetic, and geographical factors may play a part [7, 8, 9]. Specific environmental/metabolic factors including, Epstein Barr virus, seasonality in MS patients’ birth, sun exposure, vitamin D levels, and cigarettes have been shown to influence epidemiologic patterns in MS [10, 11]. The differences in susceptibility to MS, despite the same environmental exposures, indicates the involvement of genetic factors in the development of pathogenesis [7]. In recent years, genetic studies suggest that a single susceptible locus is not sufficient to lead to MS and that MS is a heterogeneous disease [12, 13]. Therefore, it is likely that multiple gene mutations are needed to contribute additively to the course of this disease [14]. In major gene regions, most of the loci associated with MS susceptibility are located at the major histocompatibility complex (MHC) which is also called the
In addition to vitamin D, the vitamin D receptor (
Since there is disagreement in the literature, the aim of the current study was to investigate the relationship between the
A total of 474 ethnically matched participants from the Turkish population were enrolled in the study. Of the 474 participants, 271 were diagnosed with MS. Within the MS patients 2 of them had Primary Progressive Multiple Sclerosis (PPMS), 184 of them had Relapsing Remitting Multiple Sclerosis (RRMS) and 85 of them had Secondary Progressive Multiple Sclerosis (SPMS). 203 individuals served as healthy controls. All patients were referred to Goztepe Training and Research Hospital and were clinically diagnosed with MS, according to the McDonald’s criteria [27]. A blood sample was collected from each person in order to obtain genomic DNA. The study protocol and consent were approved by Marmara University Medical School Clinical Research Ethic Committee. Written informed consent was obtained from all of the participants and there was no patient or control younger than the age of 16 in the study.
Genomic DNA was extracted by using the salting out method, as previously described [28]. Polymorphism regions Fok-I (rs2225870), Bsm-I (rs1544410) and Taq-I (rs731236) were amplified by a polymerase chain reaction (PCR) (Techne Tc312) using specific primers, visible in Table 1. PCR was carried by a total volume of 25 μl reaction containing 0.5 μg of genomic DNA, 2.5 μl 10x bufer, 1.5 mM MgCl2, 0.5 μM forward primer, 0.5 μM reverse primer, 0.2 mM dNTP, and 0.5 U Taq polymerase. The PCR sample were denatured at 94°C for 3 min (1x) for initial denaturation and the main PCR cycle for denaturation is at 94°C for 30 secs, annealing at 69°C for 30 secs, extension at 72°C for 45 secs (all cycles 40x), and final extension was done at 72°C for 10 min (1x) (annealing 69°C for Fok-I, 66°C for Bsm-I and 68°C for Taq-I). The PCR products were digested by Fok-I, Bsm-I, and Taq-I restriction enzymes (CutSmart, New England Biolabs inc.). 10 μl of PCR product was mixed with 5 U restriction enzyme, 3 μl 10X reaction buffer and incubated overnight at 37°C for Fok-I, at 65°C for 3 hours for Bsm-I, at 65°C for 3 hours for Taq-I. The digested PCR products were run on 1.5% agarose gel electrophoreses and genotyping was determined based on fragment size of digested PCR products. Digestion of Fok-I gives C/C (343 bp for homozygote mutant), T/C (343 bp, 267 bp, 76 bp for heterozygote) and T/T (267 bp, 76 bp for homozygote wild type). The digestion of Bsm-I gives A/A (531 bp for homozygote mutant), G/A (531 bp, 329 bp, 202 bp for heterozygote) and G/G (329 bp, 202 bp for homozygote wild type). The digestion of Taq-I gives T/T (479 bp for homozygote wild type), C/T (479 bp, 294 bp, 185 bp for heterozygote) and C/C (294 bp, 185 bp for homozygote mutant).
Primers used for amplification of polymorphism sites on the
Polymorphism | Forward Primer | Reverse Primer |
---|---|---|
Fok-I (rs2228570) | AGGATGCCAGCTGGCCCTGGCAC | TGGCTGTGAGCGCCGCATGTTCCATG |
Bsm-I (rs1544410) | TCCTTGAGCCTCCAGTCCAGG | GCAACCTGAAGGGAGACGTAGC |
Taq-I (rs731236) | AGAGCATGGACAGGGAGCAAGGC | TAGCTTCATGCTGCACTCAGGCTGG |
Comparison of genotype or allele between MS and control or MS subtypes were determined by using Pearson’s chi-square test. The odds ratio and a 95% confidence interval were also used. Values of p<0.05 were considered significant. Data was analyzed with the SPSS 21.0 program. The statistical power of this study was calculated by using the G*Power program version of 3.1.9.6.
VDR gene polymorphisms (Fok-I, Taq-I and Bsm-I) were determined in both MS and healthy people in the Turkish population. The distribution of the genotypes of Bsm-I, Fok-I, and Taq-I polymorphisms between MS/MS subtype group and control group are shown in Table 2a, Table 3a, and Table 4a, respectively. Chi-square tests were performed for the distribution of
Genotype distribution and allele frequency of
a) | Bsm-I Genotype | |||||
---|---|---|---|---|---|---|
G/G | G/A | A/A | Total | |||
37.0% (n=75) | 46.3% (n=94) | 16.7% (n=34) | 100% (n=203) | |||
35.8% (n=97) | 44.3% (n=120) | 19.9% (n=54) | 100% (n=271) | 100 | ||
36.3% (n=172) | 45.1% (n=214) | 18.6% (n=88) | 100% (n=474) | |||
37.0% (n=75) | 46.3% (n=94) | 16.7% (n=34) | 100% (n=203) | |||
35.9% (n=66) | 46.7% (n=86) | 17.4% (n=32) | 100% (n=184) | |||
35.3% (n=30) | 38.8% (n=33) | 25.9% (n=22) | 100% (n=85) | 100 | ||
50.0% (n=1) | 50.0% (n=1) | 0.0% (n=0) | 100% (n=2) | |||
36.3% (n=172) | 45.1% (n=214) | 18.6% (n=88) | 100% (474) | |||
G | A | Total | ||||
60.1% (n=244) | 39.9% (n=162) | 100% (n=406) | ||||
57.9% (n=314) | 42.1% (n=228) | 100% (n=542) | 100 | |||
58.9%(n=558) | 41.1% (n=390) | 100% (n=948) | ||||
60.1% (n=244) | 39.9% (n=162) | 100% (n=406) | ||||
59.2% (n=218) | 40.8% (n=150) | 100% (n=368) | ||||
54.7% (n=93) | 45.3% (n=77) | 100% (n=170) | 100 | |||
75.0% (n=3) | 25.0% (n=1) | 100% (n=4) | ||||
58.8% (n=558) | 41.2% (n=390) | 100% (n=948) |
Genotype distribution and allele frequency of
a) | Fok-I Genotype | |||||
---|---|---|---|---|---|---|
T/T | T/C | C/C | Total | |||
13.3% (n=27) | 38.9% (n=79) | 47.8% (n=97) | 100%(n=203) | |||
22.5% (n=61) | 35.8% (n=97) | 41.7% (n=113) | 100%(n=271) | 100 | ||
18.6% (n=88) | 37.1% (n=176) | 44.3% (n=210) | 100%(n=474) | |||
13.3% (n=27) | 38.9% (n=79) | 47.8% (n=97) | 100%(n=203) | |||
23.3% (n=43) 21.1% (n=18) | 33.2% (n=61) 42.4% (n=36) | 43.5% (n=80) 36.5% (n=31) | 100%(n=184) 100%(n=85) | 100 | ||
0.0% (n=0) | 0.0% (n=0) | 100%.0 (n=2) | 100%(n=2) | |||
18.6% (n=88) | 37.1% (n=176) | 44.3% (n=210) | 100%(n=474) | |||
T | C | Total | ||||
32.8% (n=133) | 67.2% (n=273) | 100% (n=406) | ||||
40.4% (n=219) | 59.6% (n=323) | 100% (n=542) | 100 | |||
37.1% (n=352) | 62.9% (n=596) | 100% (n=948) | ||||
32.8% (n=133) | 67.2% (n=273) | 100% (n=406) | ||||
39.9% (n=147) | 60.1% (n=221) | 100% (n=368) | ||||
42.4% (n=72) | 57.6% (n=98) | 100% (n=170) | 100 | |||
0.0% (n=0) | 100.0% (n=4) | 100% (n=4) | ||||
37.1% (n=352) | 62.9% (n=596) | 100% (n=948) |
Genotype distribution and allele frequency of
a) | Taq-I Genotype | |||||
---|---|---|---|---|---|---|
C/C | C/T | T/T | Total | |||
16.7% (n=34) | 45.8% (n=93) | 37.5% (n=76) | 100%(n=203) | |||
26.6% (n=72) | 40.6% (n=110) | 32.8% (n=89) | 100%(n=271) | 99 | ||
22.4% (n=106) | 42.8% (n=203) | 34.8% (n=165) | 100%(n=474) | |||
16.7% (n=34) | 45.8% (n=93) | 37.5% (n=76) | 100%(n=203) | |||
23.9% (n=44) | 43.5% (n=80) | 32.6% (n=60) | 100%(n=184) | |||
32.9% (n=28) | 34.2% (n=29) | 32.9% (n=28) | 100%(n=85) | 100 | ||
0.0% (n=0) | 50.0% (n=1) | 50.0% (n=1) | 100%(n=2) | |||
22.4% (n=106) | 42.8% (n=203) | 34.8% (n=165) | 100%(n=474) | |||
T | C | Total | ||||
60.3% (n=245) | 39.7% (n=161) | 100% (n=406) | ||||
53.1% (n=288) | 46.9% (n=254) | 100% (n=542) | 99 | |||
56.2% (n=533) | 43.8% (n=415) | 100% (n=948) | ||||
60.3% (n=245) | 39.7% (n=161) | 100% (n=406) | ||||
54.3% (n=200) | 45.7% (n=168) | 100% (n=368) | ||||
50.0% (n=85) | 50.0% (n=85) | 100% (n=170) | 100 | |||
75.0% (n=3) | 25.0% (n=1) | 100% (n=4) | ||||
56.2% (n=533) | 43.8% (n=415) | 100% (n=948) |
There were significant differences in Fok-I (Table 3a), Taq-I (Table 4a) polymorphism genotype distributions across MS/MS subtype group and control group. Distribution of the Fok-I polymorphism T/T genotype was 22.5 % (n=61) in the MS group and 13.3% (n=27) in the control group. Otherwise, the distribution of the Fok-I polymorphism C/C genotype was 41.7% (n=113) in the MS group and 47.8 % (n=97) in the control group (Pearson test; p<0.05). The distribution of the Taq-I polymorphism T/T genotype was 26.6 % (n=72) in MS group and 16.7 % (n=34) in the control group. Otherwise, the distribution of the Taq-I polymorphism C/C genotype was 32.8 % (n=89) in the MS group and 37.5 % (n=76) in the control group (Pearson test; p<0.05). Distribution of Fok-I (Table 6a-d) and Taq-I polymorphisms (Table 7a-d) in the MS and control groups differ significantly in dominant, heterozygote, and homozygote inheritance models (Pearson test; p<0.05). However, Fok-I and Taq-I polymorphism genotypes within any binary comparison of MS subtype group and control group were similar (Pearson test; p>0.05). There was no significant difference in Bsm-I (Table 2a, Table 5a-d) polymorphism genotype distribution across MS/MS subtype group and the control group in any inheritance models (Pearson test; p>0.05). Of the 271 MS patients and 203 healthy controls, the
Genotype distribution of
a) Bsm-I Recessive Model | ||||
---|---|---|---|---|
G/G or G/A | A/A | Total | ||
83.3% (n=169) | 16.7% (n=34) | 100% (n=203) | ||
80.1% (n=217) | 19.9% (n=54) | 100% (n=271) | ||
81.4%(n=386) | 18.6% (n=88) | 100% (n=474) | ||
G/G | G/A or A/A | Total | ||
36.9% (n=75) | 63.1% (n=128) | 100% (n=203) | ||
35.8% (n=97) | 64.2% (n=174) | 100% (n=271) | ||
36.3%(n=172) | 63.7% (n=302) | 100% (n=474) | ||
G/G | A/A | Total | ||
68.8% (n=75) | 31.2% (n=34) | 100% (n=88) | ||
64.2% (n=97) | 35.8% (n=54) | 100% (n=172) | ||
33.8%(n=88) | 66.2% (n=172) | 100% (n=260) | ||
G/G | G/A | Total | ||
44.4% (n=75) | 55.6% (n=94) | 100% (n=169) | ||
44.7% (n=97) | 55.3% (n=120) | 100% (n=217) | ||
55.4%(n=214) | 44.6% (n=172) | 100% (n=386) |
The proportions of the alleles of Bsm-I, Fok-I, and Taq-I polymorphisms are shown in Table 2b, Table 3b and Table 4b, respectively. Chi-square tests were performed for frequency of the
Genotype distribution of
a) | Fok-I Recessive Model | |||
---|---|---|---|---|
T/C or TT | C/C | Total | ||
52.2% (n=106) | 47.8% (n=97) | 100% (n=203) | ||
58.3% (n=158) | 41.7% (n=113) | 100% (n=271) | ||
55.7%(n=264) | 44.3% (n=210) | 100% (n=474) | ||
T/T | T/C or C/C | Total | ||
13.3% (n=27) | 86.7% (n=176) | 100% (n=203) | ||
22.5% (n=61) | 77.5% (n=210) | 100% (n=271) | ||
18.6%(n=88) | 81.4% (n=386) | 100% (n=474) | ||
T/T | C/C | Total | ||
21.8% (n=27) | 78.2% (n=97) | 100% (n=124) | ||
35.1% (n=61) | 64.9% (n=113) | 100% (n=174) | ||
29.5%(n=88) | 70.5% (n=210) | 100% (n=298) | ||
T/T | T/C | Total | ||
25.5% (n=27) | 74.5% (n=79) | 100% (n=106) | ||
38.6% (n=61) | 61.4% (n=97) | 100% (n=158) | ||
33.8%(n=88) | 66.7% (n=176) | 100% (n=264) |
Genotype distribution of
a) | Taq-I Recessive Model | |||
---|---|---|---|---|
T/C or T/T | C/C | Total | ||
62.6% (n=127) | 37.4% (n=76) | 100% (n=203) | ||
67.2% (n=182) | 32.8% (n=89) | 100% (n=271) | ||
65.2%(n=309) | 34.8% (n=165) | 100% (n=474) | ||
T/T | T/C or C/C | Total | ||
16.7% (n=34) | 83.3% (n=169) | 100% (n=203) | ||
26.6% (n=72) | 73.4% (n=199) | 100% (n=271) | ||
22.4%(n=106) | 77.6% (n=368) | 100% (n=474) | ||
T/T | C/C | Total | ||
30.9% (n=34) | 69.1% (n=76) | 100% (n=110) | ||
44.7% (n=72) | 55.3% (n=89) | 100% (n=161) | ||
39.1%(n=106) | 60.9% (n=165) | 100% (n=271) | ||
T/T | T/C | Total | ||
26.8% (n=34) | 73.2% (n=93) | 100% (n=127) | ||
39.6% (n=72) | 60.4% (n=110) | 100% (n=182) | ||
34.3%(n=106) | 65.7% (n=203) | 100% (n=309) |
Among the MS patients, there were 188 males and 83 females. Distribution of the
Distribution of
a) | Bsm-I Genotype | ||||
---|---|---|---|---|---|
G/G | G/A | A/A | Total | ||
37.2% (n=70) | 43.6% (n=82) | 19.1% (n=36) | 100% (n=188) | ||
32.5% (n=27) | 45.8% (n=38) | 21.7% (n=18) | 100% (n=83) | ||
35.8% (n=97) | 44.3% (n=120) | 19.9% (n=54) | 100% (n=271) | ||
T/T | T/C | C/C | Total | ||
22.3% (n=42) | 33.0% (n=62) | 44.7% (n=84) | 100% (n=188) | ||
22.9% (n=19) | 42.2% (n=35) | 34.9% (n=29) | 100% (n=83) | ||
22.5% (n=61) | 35.8% (n=97) | 41.7% (n=113) | 100% (n=271) | ||
C/C | C/T | T/T | Total | ||
34.6% (n=65) | 41.0% (n=77) | 24.5% (n=46) | 100% (n=188) | ||
28.9% (n=24) | 39.8% (n=33) | 31.3% (n=26) | 100% (n=83) | ||
32.8% (n=89) | 40.6% (n=110) | 26.6% (n=72) | 100% (n=271) |
Distribution of
a) | Bsm-I Allele | |||
---|---|---|---|---|
G | A | Total | ||
61.7% (n=153) | 38.3% (n=95) | 100% (n=248) | ||
48.0% (n=49) | 52.0% (n=53) | 100% (n=102) | ||
57.7%(n=202) | 42.3% (n=148) | 100% (n=350) | ||
T | C | Total | ||
29.0% (n=72) | 71.0% (n=176) | 100% (n=248) | ||
30.4% (n=31) | 71.0% (n=69.6) | 100% (n=102) | ||
55.7%(n=264) | 70.6% (n=247) | 100% (n=350) | ||
T | C | Total | ||
37.5% (n=93) | 37.4% (n=76) | 100% (n=248) | ||
46.1% (n=47) | 53.9% (n=55) | 100% (n=102) | ||
40.0%(n=140) | 60.0% (n=210) | 100% (n=350) |
MS is an immune mediated chronic inflammatory demyelinating disease of CNS. While very little is known about the etiology of this disease, vitamin D as well as its receptor gene,
Previous research evaluating the effect of exogenous vitamin D in prevention of MS development based on genetic tendency has helped to establish the importance of polymorphisms [22]. The Fok-I polymorphism is a T/ C allele variation located in exon 2 which is in the translation initiation site of
The Bsm-I polymorphism is located in intron 8 of
The Taq-I polymorphism is found at exon 9 of