This work is licensed under the Creative Commons Attribution 4.0 International License.
The genus Paratylenchus (Ciobanu et al., 2003) is commonly known as pin nematodes that are ectoparasites and can be frequently found at high density in perennial plants, hop gardens, orchards, or forest trees (Ghaderi et al., 2016; Ghaderi, 2019). Although sometimes plants infected by Paratylenchus species show no specific symptoms, large populations of Paratylenchus spp. affect the absorption capacity of roots and the general physiology of plants (Ghaderi, 2019). According to Talavera and Navas (2002), Paratylenchus is only considered damaging nematodes at a density higher than 500 nematodes per 100 cm3 of soil. However, several studies reported that the population of Paratylenchus can increase from a low number to damaging levels within a short time (Faulkner, 1964; Brzeski et al., 1975). The identification of Paratylenchus species was mostly based on morphological characterizations (Ghaderi et al., 2016), but morphological variation can be an obstacle to the identification process, which make the molecular approach to become more popular in recent studies of pin nematodes. In Vietnam, 16 Paratylenchus species have been reported without molecular data, including Paratylenchus aculentus, P. arculatus, P colbrani, P corbetti, P. costatus, P. dianthus, P. discocephalus, P. elachistus, P. epicotylus, P. laocaiensis, P. minusculus, P. nawadus, P. pandatus, P. perlatus, P. serricaudatus, and P. similis (Nguyen and Nguyen, 2000; Nguyen et al., 2004). In this study, we provide the first report of Paratylenchus lepidus (Raski, 1975) in Vietnam using the combination of morphological and molecular characterizations.
Material and methods
Soil and root samples were collected from the rhizosphere of green tea (Camellia sinensis (L.) Kuntze) in Vietnam. Nematodes were extracted using the modified Baermann tray method (Whitehead and Hemming, 1965). After that, they were fixed and prepared to make permanent slides following Nguyen et al. (2019a). For morphological characterization, measurements and pictures were taken using Carl Zeiss Axio Lab. A1 light microscope equipped with a Zeiss Axiocam ERc5s digital camera. For molecular characterization, the D2-D3 region of 28S rDNA and COI mtDNA gene were amplified using D2A/D3B (5′–ACAAGTACCGTGGGGAAAGTTG–3′/5′–TCGGAAGGAACCAGCTACTA–3′) (Subbotin et al., 2006) and JB3/JB4 (5′-TTTTTTGGGCATCCTGAGGTTTAT-3′/5′-TAAAGAAAGAACATAATGAAAATG-3′) (Nguyen et al., 2019b) primers. Forward and reverse sequences were assembled using Geneious R11 (www.geneious.com). The best fit model was chosen using Mega 7 and phylogenetic analysis was done following Nguyen et al. (2019c).
The female of Vietnamese population of Paratylenchus lepidus is characterized by having a slender body, curved ventrally; lateral field with four incisures; lip region weakly sclerotized, continuous to body contour; median bulb elongate with a distinct valve; isthmus slender, surrounded by nerve ring; basal bulb pyriform; secretory-excretory pore located at level of basal bulb to pharyngo-intestinal junction; hemizonid located just anterior to secretory-excretory pore; gonad monodelphic, post uterine sac absent; vulval lips not protruding but having prominent advulval flap; tail curved ventrally with a finely rounded to bluntly pointed terminus (Fig. 1). Male was not found.
Figure 1:
Female of P. lepidus from green tea in Vietnam. A: Entire body; B: Anterior end region; C to F: Variation of the tail region.
Molecular characterization
The 28S rDNA sequence of P. lepidus from Vietnam (742 bp long, accession number: MT808205) was 99.7% similar (2 bp difference) to the sequence of P. lepidus from GenBank (accession number: MK886692). The phylogenetic tree based on 28S rDNA sequences showed that the sequence of P. lepidus from Vietnam was placed together with the sequence of P. lepidus from GenBank (100% PP) (Fig. 2). A COI mtDNA sequence of P. lepidus from Vietnam (418 bp long) was also obtained and submitted to GenBank under the accession number MT828831.
Figure 2:
Bayesian inference phylogenetic tree generated from 28S rDNA sequences under HKY + G model (BIC = 2089.633, lnL = −740.031, G = 0.23, R = 3.22, f(A) = 0.226, f(T) = 0.182, f(C) = 0.249, f(G) = 0.343). Bayesian posterior probabilities (in percentage) are given next to each node. Sequences of P. lepidus from Vietnam are in bold font.
Remarks
Morphology of P. lepidus from green tea in Vietnam is in agreement with the description of the type population (Raski, 1975) with small variations in measurements, however, these variations can be seen from the type population and other populations (Maria et al., 2019). In this study, molecular identification is in agreement with morphological identification to support the presence of P. lepidus in Vietnam. The first COI mtDNA sequence of P. lepidus is also provided to serve as a molecular barcode for molecular identification of Paratylenchus species in the future.