<abstract xmlns="http://www.w3.org/1999/xhtml"><p>The family Taeniidae is of great importance in the medical and veterinary fields, particularly in the tropics and subtropics. Identification of eggs of different <italic>Taenia</italic> spp. in the final host by morphological examination is difficult owing to their similarity. Therefore, a multiplex polymerase chain reaction (PCR) targeting a mitochondrial gene was applied to identify morphologically indistinguishable eggs. Fecal samples from 100 domestic dogs, from the Mazandaran province in Iran, were examined using the flotation/sieving method followed by multiplex PCR. Taeniid eggs were observed in 24 % samples, of which 12 %, 10 %, and 2 % were infected with <italic>Echinococcus granulosus, Taenia</italic> spp., and both <italic>E. granulosus</italic> and <italic>Taenia</italic> spp., respectively. <italic>E. multilocularis</italic> was absent in these samples. The prevalence of <italic>E. granulosus</italic> in the examined domestic dogs as definitive hosts in north of Iran was high (14 %). Therefore, people living in this region of Iran are in danger of acquiring hydatid cyst, which is a serious public health problem.</p></abstract>

The family Taeniidae is of great importance in the medical and veterinary fields, particularly in the tropics and subtropics. Identification of eggs of different Taenia spp. in the final host by morphological examination is difficult owing to their similarity. Therefore, a multiplex polymerase chain reaction (PCR) targeting a mitochondrial gene was applied to identify morphologically indistinguishable eggs. Fecal samples from 100 domestic dogs, from the Mazandaran province in Iran, were examined using the flotation/sieving method followed by multiplex PCR. Taeniid eggs were observed in 24 % samples, of which 12 %, 10 %, and 2 % were infected with Echinococcus granulosus, Taenia spp., and both E. granulosus and Taenia spp., respectively. E. multilocularis was absent in these samples. The prevalence of E. granulosus in the examined domestic dogs as definitive hosts in north of Iran was high (14 %). Therefore, people living in this region of Iran are in danger of acquiring hydatid cyst, which is a serious public health problem.

Application of multiplex PCR for the simultaneous detection of <italic>Taenia</italic> spp. from domestic dogs in the north of Iran

Toxoplasmosis Research Center, Mazandaran University of Medical Science, Sari, Iran

Student Research Committee, Mazandaran University of Medical Sciences

Infectious and Tropical Diseases Research Centre, Tabriz University of Medical Sciences, Tabriz, Iran

Helminthologia

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Application of multiplex PCR for the simultaneous detection of  spp. from domestic dogs in the north of Iran

The family Taeniidae is of great importance in the medical and veterinary fields, particularly in the tropics and subtropics. Identification of eggs of...

Parasite	Target	Name	Primer sequence (5′-3′)	Amplicon size (bp)
E. multilocularis	nadl	Cesti	TGCTGATTTGTTAAAGTTAGTGATC	395 bp
E. multilocularis	nadl	Cest2	CATAAATCAATGGAAACAACAACAAG	395 bp
E. granulosus	rrnS	Cest4	GTTTTTGTGTGTTACATTAATAAGGGTG	117 bp
E. granulosus	rrnS	Cest5	GCGGTGTGTACMTGAGCTAAAC	117 bp
Taenia spp.	rrnS	Cest3	YGAYTCTTTTTAGGGGAAGGTGTG	267 bp
Taenia spp.	rrnS	Cest5	GCGGTGTGTACMTGAGCTAAAC	267 bp

Infection	Sex		Age		Total(n: 100)
Infection	Male(n: 56)	Female(n: 44)	12 month> (n: 21)	12 month ≤(n: 79)	Total(n: 100)
E. granulosus	8.9 % (5)	15.9 % (7)	14.2 % (3)	11.3 % (9)	12 % (12)
Taenia spp.	12.5 % (7)	6.8 % (3)	9.5 % (2)	10.1 % (8)	10 % (10)
E. multilocularis	0	0	0	0	0
Mixed infection(E. granulosus and Taenia spp.)	3.5 % (2)	0	4.7 % (1)	1.2 % (1)	2 % (2)
p value	>0.05		>0.05
Total	24.9 % (14)	22.7 % (10)	27.4 % (6)	22.6 % (18)	24 % (24)

Application of multiplex PCR for the simultaneous detection of Taenia spp. from domestic dogs in the north of Iran

Article Category: Research Note

Online veröffentlicht: 22. Juli 2016

Seitenbereich: 285 - 289

Eingereicht: 06. Sept. 2015

Akzeptiert: 23. März 2016

DOI: https://doi.org/10.1515/helmin-2016-0017

Schlüsselwörter
Cestoda, spp, Multiplex Polymerase Chain Reaction (PCR)

© 2016 Institute of Parasitology, SAS, Košice

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Fig. 1

The applied primers characteristics for multiplex PCR

Prevalence of infectivity of domestic dogs in north of Iran using multiplex PCR from DNA of taeniid eggs from faecal samples according to sex and age (N=100)

Application of multiplex PCR for the simultaneous detection of Taenia spp. from domestic dogs in the north of Iran

Article Category: Research Note

Online veröffentlicht: 22. Juli 2016

Seitenbereich: 285 - 289

Eingereicht: 06. Sept. 2015

Akzeptiert: 23. März 2016

DOI: https://doi.org/10.1515/helmin-2016-0017

SchlüsselwörterCestoda, spp, Multiplex Polymerase Chain Reaction (PCR)

© 2016 Institute of Parasitology, SAS, Košice

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Fig. 1

The applied primers characteristics for multiplex PCR

Prevalence of infectivity of domestic dogs in north of Iran using multiplex PCR from DNA of taeniid eggs from faecal samples according to sex and age (N=100)

Schlüsselwörter
Cestoda, spp, Multiplex Polymerase Chain Reaction (PCR)