Open Access

A Potential Relationship Between Estrogen Receptors Polymorphisms, Sperm Function and in vitro Fertilization Success: A Preliminary Study*

Joanna Talarczyk-Desole
Joanna Talarczyk-Desole
, 
Mirosław Andrusiewicz
Mirosław Andrusiewicz
, 
Małgorzata Chmielewska
Małgorzata Chmielewska
, 
Anna Berger
Anna Berger
, 
Leszek Pawelczyk
Leszek Pawelczyk
, 
Piotr Jędrzejczak
Piotr Jędrzejczak
 and 
Małgorzata Kotwicka
Małgorzata Kotwicka
   | May 12, 2021
Postępy Higieny i Medycyny Doświadczalnej's Cover Image
About this article
Previous Article
Next Article
Cite
Article Category: Original Article
Published Online: May 12, 2021
Page range: 304 - 316A
Received: Oct 23, 2019
Accepted: Jul 31, 2020
DOI: https://doi.org/10.5604/01.3001.0014.8782
Keywords
© 2021 Joanna Talarczyk-Desole et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Comparison of median sperm parameters and fertilization rate of conventional IVF and ICSI between the genotypes for ESR1 and ESR2 SNPs

Genotype Sperm concentration [mln/mL] Sperm motility [%] Sperm morphology [%] HOS [%] Oocytes fertilized in conventional IVF [%] Oocytes fertilized in ICSI [%]
ESR1
PvuII p = 0.36a p = 0.6a p = 0.9a p = 0.54a p = 0.16a p = 0.75a
TT
TC
CC
XbaI p = 0.31a p = 0.71a p = 0.33a p = 0.78a p = 0.73a p = 0.97a
AA
AG
GG
ESR2
AluI p = 0.94a p = 0.88a p = 0.69a p = 0.72a p = 0.25a p = 0.97a
AA
AG
GG
RsaI p = 0.32b p = 0.71b p = 0.21b p = 0.47b p = 0.53b p = 0.67b
GG
GA
AlwNI p = 0.1b p = 0.12a p = 0.31a p = 0.4a p = 0.79a p = 0.86a
CC
CT
TT

ESR1 and ESR2 gene primers for PCR

Primer’s name Sequence 5′ 3′ Annealing temperature Amplicon length
ESR1_rs9340799_XbaI_FESR1_rs2234693_PvuII_F CTGCCACCCTATCTGTATCTTTTCCTATTCTCC 71°C 1374 bp
ESR1_rs9340799_XbaI_RESR1_rs2234693_PvuII_R TCTTTCTCTGCCACCCTGGCGTCGATTATCTGA
ESR2_rs4986938_AluI_F GTGTGTGGTGGGACACAGAG 65°C 646 bp
ESR2_rs4986938_AluI_R AGGCCATTGAGTGTGGAAAC
ESR2_rs1256049_RsaI_F TTCTGAGCCGAGGTCGTAGT 66°C 582 bp
ESR2_rs1256049_RsaI_R TGAATCCTTGGACCCAACTC
ESR2_rs1256120_AlwNI_F GACTTTGTCACACACCTGCG 68°C 620 bp
ESR2_rs1256120_AlwNI_R AAACAGGCCACCGTCAGAAA

Additional information in studies reporting genetics of infertility. The format depends on locus biotype and study approach

Information Input Source
Reference SNP ID number (rs#) ESR1 rs2234693, ESR1 rs9340799, ESR2 rs1256120, ESR2 rs1256049, ESR2 rs4986938 dbSNP (http://www.ncbi.nlm.nih.gov/SNP/)
Polymorphism biotype rs2234693, rs9340799 – intron variantrs1256120 – Genic Upstream Transcript Variantrs1256049 – Synonymous Variantrs4986938 – 3 Prime UTR Variant dbSNP (http://www.ncbi.nlm.nih.gov/SNP/)
Minor allele frequency (MAF) rs2234693 C = 0.46781/125568, TOPMEDrs9340799 G = 0.31393/125568, TOPMEDrs1256120 G = 0.21146/125568, TOPMEDrs1256049 T = 0.06595/246214, GnomADrs4986938 T = 0.31057/239640, GnomAD dbSNP (http://www.ncbi.nlm.nih.gov/SNP/)
P value 0.02 Research
Odds ratio (OR) n/a Research
Method / platform - details PCR-RFLP Research
Repeat unit Not applicable Research
Number of repeats Not applicable Research
Gene regulation Not applicable Research
MicroRNA (miRBase ID) Not applicable Sanger miRBase (http://www.mirbase.org/)
Disease comorbidity, associated syndrome Not applicable Research
CNV type Not applicable Research
Overlapping gene Not applicable Research
Epigenetic mechanism Not applicable Research
Chromosomal aberration Not applicable Research

Average sperm parameters in patients who underwent conventional IVF and ICSI

IVF ICSI
Mean ± SD Median Mean ± SD Median p
Concentration [mln/mL] 39±16 40 18±18 13 <0.0001a
Progressive motility [%] 25±9 21 14±10 12 <0.0001a
Correct morphology [%] 5±2 5 3±2 3 <0.0001a
HOS [%] 62±11 63 48±19 50 <0.0001b

Thermal profiles for PCR reactions

Restriction site XbaI PvuII AluI RsaI AlwNI Cycles no.
Initial denaturation 95°C, 5 min 95°C, 5 min 95°C, 5 min 95°C, 5 min 1
Denaturation 95°C, 20 s 98°C, 20 s 98°C, 20 s 98°C, 20 s 30
Annealing 71°C, 15 s 65°C, 15 s 66°C, 15 s 68°C, 15 s
Elongation 72°C, 15 s 72°C, 15 s 72°C, 15 s 72°C, 15 s
Final elongation 72°C, 3 min 72°C, 1 min 72°C, 1 min 72°C, 1 min 1

Restriction enzymes and allelic sites for ESR1 and ESR2 genes

Enzyme Restriction site Allele Product length
ESR1_rs9340799_XbaI T*CTAGA T*CTAGA 981bp + 393bp
TCTGGA 1374 bp
ESR1_rs2234693_PvuII CAG*CTG CAG*CTG 936bp + 438 bp
CAGCCG 1374 bp
ESR2_rs4986938_AluI AG*CT AG*CT 445 bp + 201 bp
GGCT 646 bp
ESR2_rs1256049_RsaI GT*AC GT*AC 293 bp + 289 bp
GTGC 582 bp
ESR2_rs1256120_AlwNI CAGNNN*CTG CAGNNN*CTG 158 bp + 462 bp
CAGNNNCCG 620 bp

ESR1 and ESR2 SNPs vs. sperm parameters

Genotype Sperm concentration P Sperm progressive motility P Sperm morphology P HOS P Normozoospermia P
< 15 mln/mL ≥ 15 mln/mL < 32% ≥ 32% < 4% ≥ 4% < 58% ≥ 58% yes no
ESR1
PvuII 35 67 77 25 33 69 54 48 23 79
TT 11 (31%) 13 (19%) 0.4a 19 (25%) 5 (20%) 0.83a 8 (24%) 16 (23%) 0.98b 12 (22%) 12 (25%) 0.33a 5 (22%) 19 (24%) 0.82a
TC 16 (46%) 36 (54%) 38 (49%) 14 (56%) 17 (52%) 35 (51%) 25 (46%) 27 (56%) 13 (56%) 39 (49%)
CC 8 (23%) 18 (27%) 20 (26%) 6 (24%) 8 (24%) 18 (26%) 17 (32%) 9 (19%) 5 (22%) 21 (27%)
Powerd 0.65 0.24 0.07 0.72 0.25
T 38 (54%) 62 (46%) 0.28a 76 (49%) 24 (48%) 0.87a 33 (50%) 67 (49%) 0.85a 49 (45%) 51 (53%) 0.27a 23 (50%) 77 (49%) 0.85a
C 32 (46%) 72 (54%) 78 (51%) 26 (52%) 33 (50%) 71 (51%) 59 (55%) 45 (47%) 23 (50%) 82 (51%)
Powerd 0.63 0.06 0.06 0.63 0.06
XbaI 35 67 77 25 33 69 54 43 23 79
AA 7 (20%) 11 (16%) 0.81a 15 (19%) 3 (12%) 046b 7 (21%) 11 (16%) 0.51a 11 (20%) 7 (15%) 0.75a 2 (9%) 16 (20%) 0.22a
AG 14 (40%) 31 (46%) 35 (46%) 10 (40%) 16 (49%) 29 (42%) 23 (53%) 22 (46%) 9 (39%) 36 (46%)
GG 14 (40%) 25 (38%) 27 (35%) 12 (48%) 10 (30%) 29 (42%) 20 (27%) 19 (39%) 12 (52%) 27 (34%)
Powerd 0.21 0.74 0.66 0.70 0.99
A 28 (40%) 53 (40%) 0.95a 65 (42%) 16 (32%) 0.2a 30 (46%) 51 (37%) 0 25a 45 (35%) 36 (38%) 0.54a 13 (28%) 68 (43%) 0.07a
G 42 (60%) 81 (60%) 89 (58%) 34 (68%) 36 (64%) 87 (63%) 63 (65%) 60 (62%) 33 (72%) 90 (57%)
Powerd 0.05 0.82 0.73 0.06 0.99
ESR2
AluI 31 61 71 21 31 61 49 43 19 73
AA 3 (10%) 5 (8%) 1b 6 (8%) 2 (10%) 0.49b 2 (6%) 6 (10%) 0.54b 5 (10%) 3 (6%) 0.78b 2 (11%) 6 (8%) 0.21b
AG 13 (42%) 26 (43%) 28 (40%) 11 (52%) 11 (36%) 28 (46%) 19 (39%) 20 (47%) 11 (58%) 28 (38%)
GG 15 (48%) 30 (49%) 37 (52%) 8 (38%) 18 (58%) 27 (44%) 25 (51%) 20 (47%) 6 (31%) 39 (54%)
Powerd 0.08 0.67 0.72 0.35 0.72
A 19 (31%) 36 (30%) 0.87a 40 (28%) 15 (36%) 0.35a 15 (24%) 40 (33%) 0.23a 29 (30%) 26 (30%) 0.92a 15 (39%) 40 (27%) 0.15a
G 43 (69%) 86 (70%) 102 (72%) 27 (64%) 47 (76%) 82 (67%) 69 (70%) 60 (70%) 23 (61%) 106 (73%)
Powerd 0.06 0.68 0.82 0.05 0.92
RsaI 31 56 67 20 28 59 46 41 18 69
GG 26 (84%) 53 (95%) 0.13b 60 (90%) 19 (95%) 0.68b 23 (82%) 56 (95%) 0.11b 40 (87%) 39 (95%) 0.27b 17 (94%) 62 (90%) 1b
GA 5 (16%) 3 (5%) 7 (10%) l (5%) 5 (18 %) 3 (5%) 6 (13%) 2 (5%) 1 (6%) 7 (10%)
Powerd 0.8 0.34 0.88 0.6 0.34
G 57 (92%) 109 (97%) 0.14b 127 (95%) 39 (98%) 0.68b 51 (91%) 115 (97%) 0.11b 86 (93%) 80 (98%) 0.28b 35 (97%) 131 (95%) 1b
A 5 (8%) 3 (3%) 7 (5%) 1 (2%) 5 (9%) 3 (3%) 6 (7%) 2 (2%) 1 (3%) 7 (5%)
Powerd 0.68 0.44 0.79 0.73 0.34
A/wM 36 60 74 22 33 63 53 43 20 76
AA 0 4 (7%) 0.21b 2 (3%) 2 (9%) 0.36b 0 4 (6%) 0.06c 1 (2%) 3 (7%) 0.39b 2 (10%) 2 (3%) 0.23b
AT 13 (36%) 15 (25%) 23 (31%) 5 (23%) 14 (42%) 14 (22%) 17 (32%) 11 (26%) 4 (20%) 24 (31%)
TT 23 (64%) 41 (68%) 49 (66%) 15 (68%) 19 (58%) 45 (72%) 35 (66%) 29 (67%) 14 (70%) 50 (66%)
Powerd 0.99 0.92 0.99 0.91 0.84
A 13 (18%) 23 (19%) 0.84a 25 (17%) 7 (16%) 0.94a 14 (21%) 22 (17%) 0.53a 19 (18%) 17 (20%) 0.75a 8 (20%) 28 (18%) 0.82a
T 59 (82%) 97 (81%) 121 (83%) 35 (84%) 52 (79%) 104 (83%) 87 (82%) 69 (80%) 32 (80%) 124 (82%)
Powerd 0.07 0.07 0.27 0.11 0.11

Minimum checklist of essential information included in the studies reporting genetics of infertility, source databases and examples

Information Input Source database
Locus information Locus biotype/sequence feature/sequence variant Single nucleotide polymorphism (SNP) The Sequence ontology (http://www.sequenceontology.org/)
Sequence ontology accession SO:0001969, SO:0002153, SO:0001580, SO:0001624 The Sequence ontology (http://www.sequenceontology.org/)
Locus name / gene symbol ESR1, ESR2 HGNC (http://www.genenames.org/)
Gene name Estrogen receptor 1Estrogen receptor 2 HGNC (http://www.genenames.org/)
Entrez Gene ID 2099 (ESR1); 2100 (ESR2) Entrez (www.ncbi.nlm.nih.gov)
Chromosome number 6 (ESR1); 14 (ESR2) Ensembl (http://www.ensembl.org)
Genomic coordinate of the polymorphism, locus Chromosome # 6q25.1-q25.2 (ESR1)151656691-152,129619 (protein coding gene) (ESR1)151842246-151842246 (SNP)151842200-151842200 (SNP)Chromosome # 14q23.2-q23.3 (ESR2)64084232-64338112 (protein coding gene) (ESR2)64338283-64338283 (SNP)64257333-64257333 (SNP)64233098-64233098 (SNP) dbSNP (http://www.ncbi.nlm.nih.gov/SNP/) (SNP) Ensembl (http://www.ensembl.org) (gene)
Subjects Race / ethnicity Caucasian, Polish Research
Number of participants (infertile/controls) - include sex in each group I(M/F) C(M/F) Total study population N= 116Group 1= 40, Group 2 = 76 Only males in each group Research
Methodology PCR followed by restriction length fragment polymorphism (PCR-RFLP) Research
Phenotype information Clinical data Male patients: exclusion criteria: azoospermia, hypogonadotropic hypogonadism; erectile disorders. inclusion criteria: sperm samples provided in the process of masturbation.IVF: oocytes fertilized in standard in vitro fertilization methodICSI: oocytes fertilized by intracytoplasmic sperm injectionInclusion criteria: obtaining at least two mature oocytes from ovarian punctureExclusion criteria were as follows: over 39 years of age, FSH >12 mIU/mL.PCS, endometriosis (grade 3 or 4). Research
Disease ontology 5223 Disease Ontology (http://disease-ontology.org/)
Disease comorbidity Not available Research
PubMed ID (in review papers) No review paper referenced in the paper Research
Reference Reference (in review papers) No review paper referenced in the paper Research

ESR1 and ESR2 SNPs vs. fertilization success in conventional IVF and ICSI

Genotype Conventional IVF Fertilization completed No fertilization p ICSI Fertilization completed No fertilization p
ESR1
PvuII 36 29 7 66 61 5
TT 6 (17%) 6 (21%) 0 0.02c 18 (27%) 16 (26%) 2 (40%) 0.84a
TC 20 (55%) 18 (62%) 2 (29%) 32 (48%) 30 (50%) 2 (40%)
CC 10 (28%) 5 (17%) 5 (71%) 16 (24%) 15 (24%) 1 (20%)
Powerd 0.99 0.64
T 32 (44%) 30 (52%) 2 (36%) 0.02b 68 (52%) 62 (51%) 6 (60%) 0.75b
C 40 (56%) 28 (48%) 12 (64%) 64 (48%) 60 (49%) 4 (40%)
Powerd 0.77 0.06
XbaI 36 29 7 66 61 5
AA 4 (12%) 3 (10%) 1 (14%) 0.61a 14 (21%) 13 (21%) 1 (20%) 0.16a
AG 16 (44%) 14 (49%) 2 (29%) 29 (44%) 27 (45%) 2 (40%)
GG 16 (44%) 12 (41%) 4 (57%) 23 (35%) 21 (34%) 2 (40%)
Powerd 0.57 0.14
A 24 (33%) 20 (34%) 4 (29%) 0.76b 57 (43%) 53 (43%) 4 (40%) 1b
G 48 (67%) 38 (66%) 10 (71%) 75 (57%) 69 (57%) 6 (60%)
Powerd 0.14 0.06
ESR2
AluI 31 24 7 61 56 5
AA 2 (6%) 1 (4%) 1 (14%) 0.64a 6 (10%) 5 (9%) 1 (20%) 0.63a
AG 14 (45%) 11 (46%) 3 (43%) 25 (41%) 23 (41%) 2 (40%)
GG 15 (49%) 12 (50%) 3 (43%) 30 (49%) 28 (50%) 2 (40%)
Powerd 0.72 0.79
A 18 (29%) 13 (27%) 5 (36%) 0.52b 37 (30%) 33 (29%) 4 (40%) 0.48b
G 44 (71%) 35 (73%) 9 (64%) 85 (70%) 79 (71%) 6 (60%)
Powerd 0.36 0.76
RsaI 30 29 1 57 50 7 -
GG 24 (80%) 23 (79%) 1 (100%) - 53 (93%) 46 (92%) 7 (100%)
GA 6 (20%) 6 (21%) 0 4 (7%) 4 (8%) 0
Powerd - -
G 54 (90%) 52 (90%) 2 (100%) - 110 (96%) 96 (96%) 14 (100%) -
A 6 (10%) 6 (10%) 0 4 (4%) 4 (4%) 0
Powerd - -
AlwNI 30 24 6 66 61 5
CC 2 (13%) 2 (8%) 0 1c 2 (3%) 2 (3%) 0 0.28c
CT 5 (17%) 4 (17%) 1 (17%) 23 (35%) 23 (38%) 0
TT 23 (70%) 18 (75%) 5 (83%) 41 (62%) 36 (59%) 5 (100%)
Powerd 0.29 0.99
C 9 (15%) 8 (17%) 1 (8%) 0.67b 27 (20%) 27 (22%) 0 -
T 51 (85%) 40 (83%) 11 (92%) 105 (80%) 95 (78%) 10 (100%)
Powerd 0.46 -
eISSN:
1732-2693
Language:
English
Publication timeframe:
Volume Open
Journal Subjects:
Life Sciences, Molecular Biology, Microbiology and Virology, Medicine, Basic Medical Science, Immunology
Journal RSS Feed