Open Access

Screening of Potential Probiotic Lactobacillaceae and Their Improvement of Type 2 Diabetes Mellitus by Promoting PI3K/AKT Signaling Pathway in db/db Mice

Yueyang Li
Yueyang Li
, 
Tong Tong
Tong Tong
, 
Peifan Li
Peifan Li
, 
Yian Peng
Yian Peng
, 
Michael Zhang
Michael Zhang
, 
Jia Liu
Jia Liu
, 
Yongxin She
Yongxin She
, 
Zuming Li
Zuming Li
 and 
Yongli Li
Yongli Li
   | Sep 20, 2023
Polish Journal of Microbiology's Cover Image
About this article
Previous Article
Next Article
Cite
Article Category: Original Paper
Published Online: Sep 20, 2023
Page range: 285 - 297
Received: Apr 04, 2023
Accepted: Jun 09, 2023
DOI: https://doi.org/10.33073/pjm-2023-028
Keywords
© 2023 Yueyang Li et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Fig 1.

Changes of body weight (a) and fasting blood glucose (FBG) levels (b) in mice. Significant differences exist between values with different letters (p < 0.05).N – Control group, wt/wt mice; M – model group, db/db mice; ML – Lactobacillaceae-treated group, db/db mice with the Lactobacillaceae mixture intervention
Changes of body weight (a) and fasting blood glucose (FBG) levels (b) in mice. Significant differences exist between values with different letters (p < 0.05).N – Control group, wt/wt mice; M – model group, db/db mice; ML – Lactobacillaceae-treated group, db/db mice with the Lactobacillaceae mixture intervention

Fig 2.

Morphological alterations in the liver (a), kidney (b), pancreas (c), and colon (d).N – Control group, wt/wt mice; M – model group, db/db mice; ML – Lactobacillaceae-treated group, db/db mice with the Lactobacillaceae mixture intervention
Morphological alterations in the liver (a), kidney (b), pancreas (c), and colon (d).N – Control group, wt/wt mice; M – model group, db/db mice; ML – Lactobacillaceae-treated group, db/db mice with the Lactobacillaceae mixture intervention

Fig 3.

Colon inflammatory factor mRNA expression. Significant differences exist between values with different letters (p < 0.05).N – Control group, wt/wt mice; M – model group, db/db mice; ML – Lactobacillaceae-treated group, db/db mice with the Lactobacillaceae mixture intervention
Colon inflammatory factor mRNA expression. Significant differences exist between values with different letters (p < 0.05).N – Control group, wt/wt mice; M – model group, db/db mice; ML – Lactobacillaceae-treated group, db/db mice with the Lactobacillaceae mixture intervention

Fig 4.

PI3K, AKT protein expression electropherogram, and protein relative expression. Significant differences exist between values with different letters (p < 0.05).N – Control group, wt/wt mice; M – model group, db/db mice; ML – Lactobacillaceae-treated group, db/db mice with the Lactobacillaceae mixture intervention
PI3K, AKT protein expression electropherogram, and protein relative expression. Significant differences exist between values with different letters (p < 0.05).N – Control group, wt/wt mice; M – model group, db/db mice; ML – Lactobacillaceae-treated group, db/db mice with the Lactobacillaceae mixture intervention

Fig 5.

SCFAs content of mice in each group. Significant differences exist between values with different letters (p < 0.05).N – Control group, wt/wt mice; M – model group, db/db mice; ML – Lactobacillaceae-treated group, db/db mice with the Lactobacillaceae mixture intervention
SCFAs content of mice in each group. Significant differences exist between values with different letters (p < 0.05).N – Control group, wt/wt mice; M – model group, db/db mice; ML – Lactobacillaceae-treated group, db/db mice with the Lactobacillaceae mixture intervention

Specific gene primers used for qRT-PCR.

Gene Primers Length (bp)
IL-6 F: CCCCAATTTCCAATGCTCTCCR: CGCACTAGGTTTGCCGAGTA 141
IL-10 F: TTTAAGGGTTACTTGGGTTGCCR: AATGCTCCTTGATTTCTGGGC 106
IL-1β F: TCAAATCTCGCAGCAGCACATCR: CGTCACACACCAGCAGGTTATC 206
GAPDH F: CCTCGTCCCGTAGACAAAATGR: TGAGGTCAATGAAGGGGTCGT 133

Identification of Lactobacillaceae isolated based on 16S rDNA sequences and gene accession number assigned by NCBI.

Isolate number Species GenBank accession number Similarity (%)
4 Limosilactobacillus fermentum MT482589 99.73
5 Limosilactobacillus fermentum MT482590 99.93
6 Limosilactobacillus fermentum MT482591 99.93
8 Lactiplantibacillus plantarum MT482586 99.93
10 Lactiplantibacillus plantarum MT482587 99.80
11 Limosilactobacillus fermentum MT463724 99.93
12 Limosilactobacillus fermentum MT482592 99.93
13 Limosilactobacillus fermentum MT482593 99.93
14 Limosilactobacillus fermentum MT482594 99.93
16 Limosilactobacillus fermentum MT482595 99.93
18 Limosilactobacillus fermentum MT482596 99.93
20 Lactiplantibacillus plantarum MT482588 99.93
22 Lactiplantibacillus plantarum MT463726 99.86
25 Lactiplantibacillus plantarum MT463727 99.86
26 Limosilactobacillus fermentum MT482597 99.93
27 Limosilactobacillus fermentum MT482598 99.93
28 Limosilactobacillus fermentum MT482599 99.93
29 Limosilactobacillus fermentum MT482600 99.93
30 Limosilactobacillus fermentum MT482601 99.93
33 Limosilactobacillus fermentum MT482602 99.93
38 Limosilactobacillus fermentum MT482603 99.79
39 Limosilactobacillus fermentum MT482604 99.86
305 Limosilactobacillus fermentum MT463725 99.30

Orthogonal test of the inhibitory activities to α-amylase of Lactobacillaceae powders.

Trial A B C D Inhibitory activity (%)
1 1 1 3 2 70.00
2 1 2 1 1 82.50
3 1 3 2 3 38.00
4 2 1 2 1 71.50
5 2 2 3 3 7.50
6 2 3 1 2 31.00
7 3 1 1 3 43.00
8 3 2 2 2 30.00
9 3 3 3 1 25.50
K1 63.50 61.50 52.17 59.83
K2 36.67 40.00 46.33 43.67
K3 32.83 31.50 34.33 29.50
R 30.67 30.00 17.84 30.33
Optimum technologies A1B1C1D1 93.18 ± 1.19
SS 0.334 0.294 0.096 0.279
df 2 2 2 2
F 10.969 9.637 3.156 9.143
Significance * * *

Orthogonal test of Lactobacillaceae powders’ inhibitory activities to α-glucosidase.

Trial A B C D Inhibitory activity (%)
1 1 1 3 2 73.57
2 1 2 1 1 63.28
3 1 3 2 3 54.32
4 2 1 2 1 71.93
5 2 2 3 3 35.05
6 2 3 1 2 62.74
7 3 1 1 3 64.79
8 3 2 2 2 24.18
9 3 3 3 1 54.39
K1 63.72 70.10 63.60 63.20
K2 56.57 40.84 53.50 53.50
K3 47.79 57.15 51.39 51.39
R 15.94 29.26 12.22 11.81
Optimum technologies A1B1C1D1 75.33 ± 2.89
SS 0.076 0.258 0.057 0.048
df 2 2 2 2
F 74.785 252.387 55.709
Significance * * * *

Simulated digestion test and adhesion rates.

Isolate Survival rate (%) Adhesion rate (%)
Lactiplantibacillus plantarum 22 12.42 ± 2.84 6.94 ± 0.27
Lactiplantibacillus plantarum 25 9.10 ± 1.12 6.91 ± 0.11
Limosilactobacillus fermentum 11 5.86 ± 0.52 6.09 ± 0.39
Limosilactobacillus fermentum 305 8.82 ± 2.50 6.37 ± 0.28

Factors and levels of the orthogonal experiment of Lactobacillaceae powders.

Level A (Limosilactobacillus fermentum 11 (CFU/ml)) B (Limosilactobacillus fermentum 305 (CFU/ml)) C (Lactiplantibacillus plantarum 22 (CFU/ml)) D (Lactiplantibacillus plantarum 25 (CFU/ml))
1 108 108 108 108
2 109 109 109 109
3 1010 1010 1010 1010

The inhibitory activities to α-amylase and α-glucosidase, and the viable count of the isolates.

Isolate Viable bacteria count (109CFU/ml) α-amylase inhibitory activities (%) α-glucosidase inhibitory activities (%)
Lactiplantibacillus plantarum 8 1.71 ± 0.47ab 49.93 ± 2.06c 12.39 ± 3.05a
10 2.61 ± 0.38a 56.72 ± 8.78ab 12.60 ± 3.22a
20 2.29 ± 0.73ab 17.33 ± 5.03d 11.45 ± 4.18a
22 1.22 ± 0.47b 62.29 ± 0.44a 14.89 ± 0.38a
25 1.84 ± 0.70ab 51.81 ± 3.65bc 15.32 ± 0.89a
Limosilactobacillus fermentum 4 2.11 ± 0.64b 20.96 ± 4.95f 28.51 ± 5.73b
5 2.15 ± 0.25b 16.84 ± 8.34f 15.91 ± 0.91d
6 2.93 ± 0.28ab 44.94 ± 3.72c 19.33 ± 1.02cd
11 2.55 ± 0.30b 58.40 ± 1.68a 52.63 ± 3.07a
12 0.93 ± 0.66c 44.05 ± 4.51c 17.98 ± 9.09cd
13 2.85 ± 0.69ab 51.86 ± 4.20b 17.60 ± 1.84cd
14 2.96 ± 0.52ab 37.19 ± 7.29d 4.93 ± 0.94e
16 3.92 ± 0.38a 32.29 ± 9.59de 15.35 ± 8.28d
18 2.16 ± 0.80b 27.35 ± 7.43e 15.94 ± 1.38d
26 2.53 ± 0.98b 49.95 ± 6.54bc 15.60 ± 2.62d
27 2.49 ± 0.92b 41.39 ± 2.52cd 20.83 ± 4.58c
28 3.59 ± 0.50ab 47.92 ± 3.62bc 20.53 ± 0.17c
29 2.23 ± 0.67b 46.74 ± 3.31bc 4.99 ± 0.56e
30 2.41 ± 1.43b 55.38 ± 0.48ab 15.69 ± 1.93d
33 1.70 ± 0.90bc 47.49 ± 2.27bc 14.19 ± 2.13d
38 3.16 ± 0.77ab 50.59 ± 3.12bc 8.10 ± 4.18e
39 1.89 ± 0.59bc 37.77 ± 8.18d 5.24 ± 0.89e
305 2.04 ± 0.51bc 57.48 ± 5.04ab 51.79 ± 1.13e
eISSN:
2544-4646
Language:
English
Publication timeframe:
4 times per year
Journal Subjects:
Life Sciences, Microbiology and Virology
Journal RSS Feed