1. bookVolume 70 (2021): Issue 2 (June 2021)
Journal Details
License
Format
Journal
eISSN
2544-4646
First Published
04 Mar 1952
Publication timeframe
4 times per year
Languages
English
Open Access

First Description of Various Bacteria Resistant to Heavy Metals and Antibiotics Isolated from Polluted Sites in Tunisia

Published Online: 06 Dec 2021
Volume & Issue: Volume 70 (2021) - Issue 2 (June 2021)
Page range: 161 - 174
Received: 20 Sep 2020
Accepted: 15 Feb 2021
Journal Details
License
Format
Journal
eISSN
2544-4646
First Published
04 Mar 1952
Publication timeframe
4 times per year
Languages
English
Abstract

Environmental bacteria belonging to various families were isolated from polluted water collected from ten different sites in Tunisia. Sites were chosen near industrial and urban areas known for their high degree of pollution. The aim of this study was to investigate cross-resistance between heavy metals (HM), i.e., silver, mercury and copper (Ag, Hg, and Cu), and antibiotics. In an initial screening, 80 isolates were selected on ampicillin, and 39 isolates, retained for further analysis, could grow on a Tris-buffered mineral medium with gluconate as carbon source. Isolates were identified based on their 16S rRNA gene sequence. Results showed the prevalence of antibiotic resistance genes, especially all isolates harbored the blaTEM gene. Some of them (15.38%) harbored blaSHV. Moreover, several were even ESBLs and MBLs-producers, which can threaten the human health. On the other hand, 92.30%, 56.41%, and 51.28% of the isolates harbored the heavy metals resistance genes silE, cusA, and merA, respectively. These genes confer resistance to silver, copper, and mercury. A cross-resistance between antibiotics and heavy metals was detected in 97.43% of our isolates.

Keywords

Introduction

Since the industrial revolution, new ecological niches have emerged following the release of toxic industrial wastes, which often consist of a mixture of heavy metals, organic compounds, and hydrocarbons, into the environment. Environmental pollution is a significant problem, affecting many environments in a negative and almost irreversible way (Filali et al. 2000). In particular, heavy metal contamination of surface waters directly impacts both the environment and public health (Chihomvu et al. 2015). Environmental bacteria that are resistant to heavy metals, as well as multiple antibiotics, are of great concern in many areas of the world.

Bacteria-heavy metal interactions have been studied in many and extreme environments. Some metals are essential cofactors of specific proteins; others cause oxidative stress because of their redox potential. Heavy metals are naturally occurring, but with excessive anthropogenic activities, they are shown in large quantities, then become toxic at high concentration. Soil, water, and air are the major environmental compartments, which are affected by heavy metals pollution leading to many adverse impacts (Tchounwou et al. 2012).

In this study, we focused on copper, silver, and mercury. These heavy metals are more and more used in many applications and are also found in different areas worldwide (Kerfoot et al. 2002; 2004).

Copper is an essential element that is toxic at high concentrations (Chihomvu et al. 2015). High cytoplasmic copper concentrations can lead to dysfunctional proteins (Kershaw et al. 2005), or damage lipids, DNA, and other molecules (Harrison et al. 2000). Microorganisms have developed several copper resistance mechanisms to survive in contaminated environments.

Silver is used as an antimicrobial agent in various medical products, such as catheters, and for burns wound treatments (Silver and Phung 1996; Klasen 2000; Jung et al. 2008). Bacteria can develop resistance to silver via efflux mechanisms encoded by the sil- or pco/cop-genes (Gupta et al. 1999).

The mercury ion has been known to be effective against a broad range of microorganisms. It has no beneficial functions in living organisms, and this toxic compound can accumulate in the food chain (Jan et al. 2009). The mercury resistance system is encoded by the mer operon, which reduces Hg2+ into elemental mercury via the mercuric reductase enzyme (MerA) (Boyd and Barkay 2012; Fatimawali et al. 2014).

Furthermore, many reports suggested that heavy metal contamination could directly or indirectly impact the maintenance and proliferation of antibiotic resistance (Summers 2002). Several studies reported the co-occurrence of heavy metal and antibiotic resistance. It has been proven that heavy metals in environmental reservoirs, water, wastewater, and soil, may contribute to the selection of antibiotic-resistant strains through co-resistance and cross-resistance mechanisms (Nguyen et al. 2019). It is important to underline that co-resistance occurs when genes coding for the resistance phenotypes are present on the same mobile genetic elements (i.e., plasmids, transposons, and integrons) (Mandal et al. 2016). Mercury, copper, and silver resistance genes are located on mobile genetic elements, e.g., on class II transposons with various antibiotic resistance genes. For instance, Salmonella plasmid pMG101 carries silver, mercury, and tellurite resistance genes and genes conferring resistance against chloramphenicol, ampicillin, tetracycline, streptomycin, and sulphonamide. Plasmid-encoded mercury resistance operons are frequently associated with class II transposons. In addition, P-type ATPases are indispensable for the transport of ions, such as copper and silver from cells, acting as a resistance mechanism to actively efflux heavy metal cations. These PIB-type ATPase genes have been found to occur on plasmids and transposons in both Gram-positive and Gram-negative bacteria and be prone to horizontal gene transfer (HGT) (Aminov 2011).

In this report, we were interested in studying the contamination of ten sites in Tunisia by silver, copper, and mercury and detecting a cross-resistance between them and antibiotics in water environmental isolates. It was done to understand better whether heavy metal contamination could contribute to the proliferation and the spread of antibiotic resistance.

Experimental
Materials and Methods

Sampling sites. Samples were collected from ten different geographic areas from the north to the south of Tunisia (Table I). Sampling sites were chosen because of their geographic situation near urban, industrial, and agricultural areas. Sample locations were based on a previous study that determined the degree of pollution (2020).

Sampling sites characteristics, locations, and their corresponding geographic coordinates.

Sites/numerationGeographic coordinatesLocationCharacteristics
Menzel Jemil, Bizerte: Site I37°14′19″N,9°54′59″EIndustrial areaWaste and contamination from the textile industry and wiring throwing inside the Bizerte lagoon
Menzel Bourguiba, Bizerte: Site II37°09′N, 9°47′EUnit manufacturing printed circuits. In the Iron factoryContamination by HM from the iron factory in the Bizerte lagoon. Urban and agricultural pollution
Tinjah wedi, Bizerte: Site III37°10′N, 9°45′ENear the lagoon of BizerteAgricultural pollution and compost contamination.
Beja: Site IV36°43′30″N,9°10′55″ESouthwest of the city of Tunis Near the CWTP*Urban and industrial area, the most known are wastewater and yeast factory
Essijoumi Lagoon: Site V36°45′52″N,10°08′49″EContribution in the Gulf of TunisLagoon receiving contamination from wastewater contamination and wastes from the capital Tunis.
Rades Milian River: Site VI36°46′N,10°17′EIndustrial zone of RadesHigh load alluvial estimated at 25 grams per liter. Receiving wastewater from two towns Rades and Ezzahra.
Majerda River: Site VII37°7′0″N,10°13′0″EA peninsula in far north-eastern TunisiaUsed for irrigation of the region’s agriculture
Lebna River: Site VIII36°45′N,10°54′EInlet manifold sewage treatment plantAgricultural coastal Plans can be found in the area of Cap Bon
Om Larayes, Gafsa: Site IX34°28′59″N,8°16′01″EThe industrial platforms of phosphgyps activityOne of the known mining towns in Gafsa
Gulf of Gabes: Site X34°05′37″N,10°26′13″EThe junction between the Eastern and Central BasinKnown by industry for the transformation of merchantable phosphate into Phosphoric Acid (H3PO4) and Chemical Fertilizers

– CWTP: Collector between wastewater treatment plant.

Sample collection and HM resistant bacteria screening. A plankton net was used to recover water samples, which were transferred into sterile bottles and transported at 4°C to the laboratory. After a first filtration step to remove insoluble solids, a nitrocellulose filter (0.45 μm) was used to collect microorganisms. Filters were directly placed on Lysogeny Broth (LB) agar plates with ampicillin (AMP) 64 μg/ml and incubated for 24–48 hrs. at 37°C. Ampicillin was used to counter select sensitive isolates. In the next step, growth on Tris-buffered mineral agar supplemented with 0.2% (w/v) sodium gluconate (MM284) (Mergeay et al. 985) was scored. Finally, 39 isolates were stored on 15% glycerol at –80°C.

Total DNA extraction. According to the manufacturer’s protocol, the total DNA of each isolate was extracted from bacterial cultures using the QIAamp DNA Maxi kit. DNA concentration (ng/μl) was measured with the Nano Drop Microvolume Quantitation of Nucleic Acids. (Thermo Scientific, NanoDrop 1000).

Amplification of the 16S rRNA gene. The 16S rRNA gene was amplified using 50–100 ng of total DNA, 25 μl of DreamTaq Green PCR Master Mix (2X), 0.1–1 μM of the universal primers 8F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Galkiewicz and Kellogg 2008), and adjusted to 50 μl with nuclease-free water. Amplification was performed in an Eppendorf Master cycler thermocycler (Hamburg, Germany) using the following conditions: initial denaturation at 95°C for 10 min, 30 cycles of 95°C for 30s, 56°C for 30s, 72°C for 2 min, and a final extension at 72°C for 10 min. The 16S rRNA gene amplicons were purified (Promega SV Gel and PCR clean-up system kit) and sequenced (Eurofins Genomics, Germany). Isolates were identified using16S rRNA sequence according to Greengenes Database.

Phylogenetic analysis. The 16S rRNA gene sequences were aligned to silva, trimmed to the same region removed those shorter than 900 bp (6 sequences), reported the phylogeny based on both filtered and complete set of sequences. The phylogenetic tree was built by the MEGA clustal algorithm, and distances calculated using “Maximum Likelihood” in MEGA X. The evolutionary history was inferred by using Maximum Likelihood and Tamura-Nei model (Tamura and Nei 1993; Kumar et al. 2016). Evolutionary analyses were conducted in MEGAX.

Antibiotic susceptibility testing. The disk diffusion agar technique determined susceptibility to antimicrobial agents. The following antibiotic disks (supplied by BioMerieux) were used: amoxicillin (10 μg), amoxicillin/clavulanic acid (20 μg/10 μg), piperacillin (100 μg), piperacillin/tazobactam (100 μg/10 μg), cephalothin (30 μg), cefotaxime (30 μg), ceftazidime (30 μg), aztreonam (30 μg), imipenem (10 μg), nalidixic acid (30 μg), ciprofloxacin (5 μg), chloramphenicol (30 μg), gentamicin (10 μg), kanamycin (30 μg), streptomycin (10 μg), sulfamethoxazole/trimethoprim (25 μg), and tetracycline (30 μg) (Vicente et al. 1990).

Determination of heavy metal minimal inhibitory concentration. To determine the MIC of heavy metals, a stationary phase culture (OD600 of ca. 1.0 representing 109 CFU/ml) of each isolate grown in Tris-buffered mineral medium (MM284) supplemented with gluconate was diluted 50 times in 2 × concentrated MM284 medium. 100 μl of each culture was added to a 96-well plate containing 100 μl of a heavy metal ion solution (Cu2+, Hg2+, and Ag+.) at increasing concentration. Plates were incubated at 30°C for 48 h in the dark on a rotary shaker. At different time points, bacterial growth was measured by determining the optical density at 595 nm. The minimal inhibitory concentration (MIC) was determined for Cu2+, Hg2+, and Ag+. Cupriavidus metallidurans CH34 and Escherichia coli K38 were used as references (Monsieurs et al. 2011). Isolates showing higher MICs than both reference strains were considered as resistant.

PCR amplification of antibiotic resistance genes. β-lactamases encoding-genes were screened as previously described (Dallenne et al. 2010) using multiplex PCR 1 for the detection of the blaTEM, blaSHV, and blaOXA-1-like genes; multiplex PCR 2 for the detection of the blaCTX-M subgroups (blaCTX-M-1, blaCTX-M-2, blaCTX-M-9, blaCTX-M-8, blaCTX-M-25), and a separate simplex PCR for the detection of the blaOXA-48 gene. Primers, amplification conditions and expected fragment sizes are shown in Table II. Fluoroquinolone resistance genes were screened using multiplex PCR 3 (qnrA, qnrB, qnrC, qnrD, qnrS, and oqxAB), as previously described (CLSI 2013). Primers, amplification conditions, and expected fragment sizes are shown in Tables II and III.

Primers, expected fragment size and conditions of PCR experiments used for β-lactams resistance encoding genes.

MultiplexTargetPrimers sequences (5′–3′)Size (pb)Concentration (pmol/µl)Volume (µl)Amplification conditions
1TEMMultiTSO-T_F CATTTCCGTGTCGCCCTTATTC8000.40.494°C 10 min 94°C 40 sec 60°C 40 sec 30 cycles 72°C 1 min 72°C 7 min
MultiTSO-T_R CGTTCATCCATAGTTGCCTGAC0.40.4
SHVMultiTSO-S_F AGCCGCTTGAGCAAATTAAAC7130.40.4
MultiTSO-S_R ATCCCGCAGATAAATCACCAC0.40.4
OXA-1-likeMultiTSO-O_F GGCACCAGATTCAACTTTCAAG5640.40.4
MultiTSO-O_R GACCCCAAGTTTCCTGTAAGTG0.40.4
2CTX-M group 1MultiCTXMGp1_F TTAGGAARTGTGCCGCTGTA6880.40.4
MultiCTXMGp1_R CGATATCGTTGGTGGTCCCAT0.20.2
CTX-M group 2MultiCTXMGp2_F CGTTAACGGCACGATGAC4040.20.2
MultiCTXMGp1_R CGATATCGTTGGTGGTTCCAT0.20.2
CTX-M group 9MultiCTXMGp9_F TCAAGCCTGCCGATCTGGT5610.40.4
MultiCTXMGp9_R TGATTCTCGCCGCTGAAG0.40.4
CTX-M group 8CTX-Mg8/25_F AACTCCCAGACGCTCTAC3260.40.4
CTX-Mg8/25_R TCGAGCCGGAASGTGTAAT0.40.4
SimplexTargetPrimers sequences (5′– 3′)Size (pb)Concentration (pmol/µl)Volume (µl)Amplification conditions
1OXA-48MultiOXA-48_F GCTTGATCGCCCTCGATT2810.40.494°C 10 min 94°C 40 sec 57°C 40 sec 30 cycles 72°C 1 min 72°C 7 min
MultiOXA-48_R GATTTGCTCCGTGGCCGAAA0.40.4

Primers, expected fragment size, and conditions of PCR experiments used for quinolones resistance encoding genes.

MultiplexTargetSequence of primer (5′–3′)Size (bp)Amplification conditions
3qnrAqnrA_FCAGCAAGAGGATTTCTCACG63095°C 15 min 94°C 30 sec 63°C 40 sec 30 cycles 72°C 90 sec 72°C 10 min
qnrA_RAATCCGGCAGCACTATTACTC
qnrBqnrB_FGGCTGTCAGTTCTATGATCG488
qnrB_RGAGCAACGATGCCTGGTAG
qnrCqnrC_FGCAGAATTCAGGGGTGTGAT118
qnrC_RAACTGCTCCAAAAGCTGCTC
qnrDqnrD_FCGAGATCAATTTACGGGGAATA581
qnrD_RAACAAGCTGAAGCGCCTG
qnrSqnrS_FGCAAGTTCATTGAACAGGGT428
qnrS_RTCTAAACCGTCGAGTTCGGCG

PCR amplification and sequencing of thesilE, merA, and cusAgenes. The silE gene, coding for a periplasmic heavy metal binding protein involved in silver resistance, the cusA gene, part of the RND-driven system effluxing copper, and the merA gene, coding for a mercury reductase detoxifying mercury stress, were amplified by PCR. The following reaction mixture (50 μl) was used: 25 μl of DreamTaq Green PCR Master Mix (2X), 0.1–1 μM of reverse and forward primer (50–100 ng) genomic DNA as previously described (Silver and Phung 1996; Besaury et al. 2013). PCR products were purified by PCR Clean-up and sequenced (Eurofins Genomics, Germany).

Protein prediction and analyses. The silE, cusA, and merA genes sequences were translated to their corresponding protein using Expasy website, then aligned using BioEdit with SilE from pMG101 (SilE AAD1171743), Escherichia coli (CusA P30854), and Enterobacter cloacae (MerA EU081910), respectively.

Results

Sample collection and identification of bacterial isolates. Ten filters placed on LB plates, each belonging to a sample collected from the ten sites, showed multiple colonies. The choice of colonies was based on shape and color. Therefore, 80 colonies were chosen from the ten plates to determine the prevalence of heavy metal- and antibiotic-resistant bacteria. In the next step, only the 39 isolates that grew on Tris-buffered mineral agar supplemented with 0.2% (w/v) sodium gluconate (MM284) (Mergeay et al. 1985) were retained. MM284 contained HM trace was used to test heavy metal resistance. Subsequently, the selected isolates were identified using the 16S rRNA gene amplification followed by sequencing, and the corresponding phylogenetic tree was dressed and presented in Fig. 1. Despite the sampling locations, the phylogenetic tree showed a similarity between species. Therefore, six clusters were shown.

Fig. 1.

Phylogenetic tree based on the partial 16S rRNA gene sequences of the 39 isolates. Ten colors used to distinguish ten different sampling sites classified from north to south of Tunisia: Dark blue: Menzel Jemil; Orange: Iron factory; Red: Tinjahwedi Bizerte; Cyan: Collector between wastewater treatment plant (CWTP) of Beja; Green: Marsh Sejoumi; Yellow: Milian Rades Wedi; Light purple: Majerda River; Pink: Lebnawedi Cap Bon; Dark purple: Om Larayes Gafsa; Grey: Golf of Gabes.

Antibiotic resistance profiles and genes. Disk diffusion tests showed that the isolates’ antibiotic resistance profiles were diverse (tested according to EUCAST 2018 guidelines). Resistance was detected against different families, including β-lactams, fluoroquinolones, aminoglycosides, tetracycline, and macrolides. We noted that isolate Aeromonas salmonicida 32 was only resistant to ampicillin by the production of TEM-1β-lactamase. The other isolates were resistant to less than two antibiotics by the production of different resistance enzymes, like CTX-M-1, OXA-48, SHV-1, CTX-M-9, or OXA-1. Only two isolates, E. coli 3 and Klebsiella pneumoniae 39 were resistant to quinolones by the expression of qnrB.

Heavy metal resistance profiles. Growth of all strains was inhibited at silver nitrate, copper, and mercury at concentrations starting from 0.032 to 0.064 mM, 1.5 to 6 mM, and from 0.02 to 0.08 mM, respectively. A high MIC value for silver was observed for 92.30% of the isolates collected from the ten sites. Only three isolates were sensitive to silver, two from Beja and Essijoumi Lagoon, and one from Melian Rades Wedi.

The growth of strains was inhibited at the copper concentrations starting from 3 to 6 mM. Copper resistance in relation with sites was as follows: 100% of sensible isolates were detected in Majerda River showing MIC values from 0.75 to 1.5 mM; < 80% of sensible isolates were detected in Gafsa (about four from a total of five isolates), which demonstrated the lowest MIC values from 0.625 to 1.5 mM; < 50% of sensible isolates were detected in Essijoumi Lagoon with MIC values similar to that of the isolates from Gafsa; < 25% of isolates were detected in each site with MIC values ranged from 0.625 to 1.5 mM. As a result, 75% of isolates resistant to copper were detected in the following Sites: I, II, III, IV, VI, IX, and X followed by 50% of the resistant isolates detected in Site V, and 20% of the isolates were detected in Gafsa (Site VIII). However, none of the isolates resistant to copper were detected in Majerda River (Site VII). Resistant and sensible isolates were detected with different percentages from one site to another as follows: 100% of isolates were detected in Lebna wedi Cab Bon with a low MIC: equal to 0.005 mM; < 75% of isolates detected in Gulf of Gabes were sensible to mercury with the MIC values ranged from 0.0025 to 0.008 mM; < 50% of sensible isolates were isolates from Bizerte (Site I, II, and III) with the MIC values ranged from 0.0025 to 0.005 mM; < 40% of isolates were sensible to mercury with the MIC values equal to 0.005 mM belonged to Site VIII; <33% sensible isolates collected from Collector between wastewater treatment plant (CWTP) of Beja, Melian Rades Wedi, and Majerda River. All isolates collected from Essoujimi River were resistant to mercury with the MIC values equal to 0.08 mM.

A high percentage of resistance to silver was shown for 92.30% of the total isolates. Furthermore, 22 isolates (56.41%) showed high resistance to copper, and about half of the isolates (51.28%) showed high resistance to mercury.

Identification of the heavy metal resistance encoding genes. PCR amplification using the specific primers provided three different amplicons with a size of 400 bp for the silE gene, 410 bp for the cusA gene, and 280 bp for the merA gene (Fig. 2). Sequencing confirmed amplification of the correct fragment and showed that silE was the most common. The silver binding protein gene silE was detected in all isolates collected from the ten sites except for one isolate from each Site (IV, V, and VI), which was deprived of it. Reported MICs of silver for resistant isolates did not inhibit colony growth at 0.032 mM to 0.064 mM (Table IV). The copper resistance gene cusA was detected in 100% isolates from Site III, 80% of isolates from Site II, 75% isolates from Site (I, VIII and X), 66% of isolates from Site IV, 50% of isolates from the Site V, 33% of isolates isolated from Site VI, and absent in isolates collected from Sites VII and XI. Reported MICs of copper for resistant isolates did not inhibit colony growth at 3 mM to 6 mM.

Fig. 2.

Detection by PCR of heavy metal resistance genes.

a – Amplicon of silE of Enterobacter cloacae 27 (400 bp);

b – Amplicon of cusA of Klebsiella pneumoniae 13 (410 bp);

c – Amplicon of merA of Pseudomonas putida 26 (285 bp);

M – Size Marker 1 kb Plus.

Phenotypic and molecular characteristics of antibiotic and heavy metal resistant isolates collected from polluted water in Tunisia.

StrainsSitesMICs of HM (µg/ml) Ag2+ Cu2+ Hg2+HM resistance genesAB resistance profileAB resistance genes
Pseudomonas anguilliseptica 1MJ. Bizerte0.064 (R) 0.625(S) 0.08 (R)silE, merAAMP, ATM, FOSblaTEM
Alcaligenes eutrophus 2MJ. Bizerte0.064 (R) 3 (R) 0.005 (S)silE, cusAAMP, CAZblaTEM
Escherichia coli. 3MJ. Bizerte0.064 (R) 6 (R) 0.0025 (S)silE, cusAAMP, TIC, PIP, CXM, CFM, CAZ, ATM, GMN, NET, TOB, CTXblaTEM, blaCTX-M-1, qnrB
Staphylococcus aureus 4MJ. Bizerte0.064 (R) 3(R) 0.08 (R)silE, cusA, merAAMP, ATM, FOS, CIP, LEVblaTEM
Pseudomonas mendocina 5IF of Bizerte MB0.032 (R) 3(R) 0.08 (R)silE, cusA, merAAMP, ATM, FOSblaTEM
Alcaligenes eutrophus 6IF of Bizerte MB0.064 (R) 6(R) 0.005 (S)silE, cusAAMP, CAZ, SXT, CHLblaTEM
Klebsiella pneumoniae 7IF of Bizerte MB0.064 (R) 3(R) 0.08 (R)silE, cusA, merAAMP, TIC, FOX, FEP, ETP, AMC, CAZ, IMP, SXT, CTX, FOS, CLS, NOR, CIP, GMN, AKN, NET, TOB, NFE, MNO, TETblaTEM, blaSHV, blaCTX-M-1, blaOX48, qnrB
Pseudomonas putida 8IF of Bizerte MB0.064 (R) 1.5 (S) 0.005 (S)silEAMP, TIC, TCC, PIP, FEP, CAZ, ATM, FOSblaTEM
Alcaligenes faecalis 9IF of Bizerte MB0.064 (R) 3 (R) 0.005 (S)silE, cusAAMP, CAZblaTEM
Pseudomonas mendocina 10Tinjah wedi, Bizerte0.064 (R) 1.5 (S) 0.08 (R)silE, cusA, merAAMP, ATM, FOSblaTEM
Pseudomonas mendocina 11Tinjah wedi, Bizerte0.032 (R) 3 (R) 0.005 (S)silE, cusAAMP, TCC, FOSblaTEM
Alcaligenes faecalis 12Tinjah wedi, Bizerte0.064 (R) 3 (R) 0.005 (S)silE, cusAAMP, CAZ, CHLblaTEM
Klebsiella pneumoniae 13Tinjah wedi, Bizerte0.032 (R) 3 (R) 0.04 (R)silE, cusA, merAAMP, TIC, AMC, NAL, NOR, CHL, TGC, MNO, TETblaTEM, blaSHV
Pseudomonas fluorescens 14CWTP of Beja0.064 (R) 3 (R) 0.005 (S)silE, cusAAMP, TIC, ATM, FOS, IMP, MEM,blaTEM
Pseudomonas putida 15CWTP of Beja0.064 (R) 1.5 (S) 0.08 (R)silE, merAAMP, TIC, TCCblaTEM
Pseudomonas putida 16CWTP of Beja0.008 (S) 3 (R) 0.04 (R)cusA, merAAMP, TIC, TCC, PIP, FEP, CAZ, ATM, FOSblaTEM
Aeromonas salmonicida 17Marsh Sejoumi0.032 (R) 1.5 (S) 0.08 (R)silE, merAAMP, TICblaTEM
Alcaligenes eutrophus 18Marsh Sejoumi0.008 (S) 0.625 (S) 0.08 (R)merAAMP, CAZblaTEM
Pseudomonas alcaligenes 19Marsh Sejoumi0.0064(R) 3 (R) 0.08 (R)silE, cusA, merAAMP, TIC, PIP, TCC, FOSblaTEM
Enterobacter cloacae 20Marsh Sejoumi0.064 (R) 6 (R) 0.08 (R)silE, cusA, merAAMP, TIC, FOX, AMC, CTXblaTEM, blaOXA-1, blaSHV, blaCTX-M-9
Bacillus coagulans 21Milian Rades Wedi0.064 (R) 3 (R) 0.02 (R)silE, cusA, merAAMP, TIC, TCC, PIP, FEP, CAZ, ATM, FOSblaTEM
Alcaligenes eutrophus 22Milian Rades Wedi0.064 (R) 0.625 (S) 0.08 (R)silE, merAAMP, CAZ, SXT, CHLblaTEM
Pseudomonas putida 23Milian Rades Wedi0.004 (S) 0.625 (S) 0.005 (S)AMP, ATM, FOSblaTEM, blaSHV
Alcaligenes eutrophus 24Majerda River0.064 (R) 1.5 (S) 0.005 (S)silEAMP, CAZblaTEM
Serratia marcescens 25Majerda River0.064 (R) 1.5 (S) 0.02 (R)silE, merAAMP, TIC, FOX, AMCblaTEM, blaOXA-1, blaSHV
Pseudomonas putida 26Majerda River0.032 (R) 0.75 (S) 0.02 (R)silE, merAAMP, FOS, ATM, LEVblaTEM
Enterobacter cloacae 27Lebna wedi C.B0.064 (R) 3 (R) 0.005 (S)silE, cusAAMP, TIC, FOX, AMC, TGC, MNO, TETblaTEM, blaOXA-1
Serratia fonticola 28Lebna wedi C.B0.064 (R) 1.5 (S) 0.005 (S)silEAMP, TIC, AMC, CTX, CLSblaTEM, blaCTX-M-9
Alcaligenes faecalis 29Lebna wedi C.B0.032 (R) 3 (R) 0.005 (S)silE, cusAAMP, CAZblaTEM
Klebsiella pneumoniae 30Lebna wedi C.B0.064 (R) 6 (R) 0.005 (S)silE, cusAAMP, TIC, AMCblaTEM, blaSHV
Pseudomonas fluorescens 31Om Larayes, Gafsa0.064 (R) 3 (R) 0.08 (R)silE, cusA, merAAMP, TIC, TCC, PIP, FEP, ATM, IMP, MEM, FOSblaTEM
Aeromonas salmonicida 32Om Larayes, Gafsa0.064 (R) 0.625(S) 0.005 (S)silEAMPblaTEM
Aeromonas salmonicida 33Om Larayes, Gafsa0.064 (R) 1.5 (S) 0.08 (R)silE, merAAMP, TIC, FEP, CAZ, ATMblaTEM
Pseudomonas putida 34Om Larayes, Gafsa0.032 (R) 1.5 (S) 0.08 (R)silE, merAAMP, TIC, TCC, PIP, TZP, CAZ, ATMblaTEM
Pseudomonas fluorescens 35Om Larayes, Gafsa0.0064 (R) 0.75 (S) 0.005 (S)silEAMP, TIC, TCC, ATM, MEMblaTEM
Pseudomonas putida 36Gulf of Gabes0.064 (R) 3 (R) 0.008 (S)silE, cusAAMP, TIC, TCC, PIP, TZP, ATM, MEMblaTEM
Serratia marcescens 37Gulf of Gabes0.064 (R) 1.5 (S) 0.005 (S)silEAMP, FOX, AMC, TGC, MNO, TETblaTEM
Pseudomonas fluorescens 38Gulf of Gabes0.0064 (R) 6 (R) 0.08 (R)silE, cusA, merAAMP, TIC, TCC, PIP, TZP, FEP, CAZ, ATM, MEM, LEV, FOSblaTEM
Klebsiella pneumoniae 39Gulf of Gabes0.032 (R) 3 (R) 0.0025 (S)silE, cusAAMP, TIC, TCC, PIP, CFN, CXM, CFM, CAZ, FEP, ATM, GMN, NET, TOBblaSHV, blaCTX-M-1, qnrB

The mercuric reductase gene merA were detected in 100%, 75%, 66%, 50%, 40%, 33%, and 25% isolates collected from Site V, IX, (IV, VI), (I, III), II, VII, X, respectively. No gene was detected in the isolates collected from Site VIII. Reported MIC of mercury for resistant isolates did not inhibit colony growth at 0.02 to 0.08 mM. Ten isolates harbored silE, cusA, and merA. For only one isolate, identified as Pseudomonas putida 23, no amplification was observed. Therefore, we observed a significant correlation between the detection of resistance genes and MIC determinations.

Structural and functional analyses of protein binding site. The complete sequence of the extracellular heavy metal-binding protein SilE of pMG101 from Salmonella (AAD1171743) is composed of 143 amino acids (Asiani et al. 2016). Sequence alignment of the partial SilE sequence obtained from the 39 isolates (this study) and the SilE of pMG101 showed that 84.6% of the SilE sequences were 100% identical to each other and the SilE of pMG101. The rest (15.4%) showed some sequence variation from the SilE of pMG101 (Fig. 3). Nevertheless, all isolates showed the conserved histidine and methionine residues in their sequences and the Ag+ binding motif characteristic to SilE (Asiani et al. 2016).

Fig. 3.

Sequence alignment of the partial SilE protein from 39 isolates with SilE from pMG101 (SilE AAD11743). Letters shows res idues different from the consensus. Conserved histidine and methionine residues are marked above with either a circle or a square, respectively.

The complete sequence of CusA efflux pump of the E. coli (CusA P30854) is composed of 1,047 amino acids. Sequence alignment of the partial CusA protein from ten isolates with CusA from E. coli (CusA P30854) showed various mutations. A minor difference detected between partial CusA sequence from E. coli 3 and the consensus E149G and V267I.

A similar partial CusA sequences from E. cloacae 27, Alcaligenes feacalis 9, Bacillus coagulans 21, and K. pneumoniae (7, 13, 30 and 39) were different by 26% residues with the consensus.

Similar partial CusA sequence was showed for Pseudomonas alcaligenes 19 and P. putida 36. Nevertheless, both of them detected a low sequence homology with 42% of different residues comparing with the consensus (Fig. 4).

Fig. 4.

Sequence alignment of the partial Cation efflux system protein CusA from 10 isolates with E. coli P30854. Different residues from the consensus are showed by one letter. Conserved residues are represented by points.

Five hundred sixty-one amino acids compose the complete sequence of the mercuric reductase MerA protein of E. cloacae (MerA EU081910). Similar partial MerA sequences of P. alcaligenes 19 and P. putida 34 were different by seven residues comparing with the consensus (E. cloacae (MerA EU081910). Moreover, K. pneumoniae (7 and 13) showed the seven different residues mentioned previously for P. alcaligenes 19 and P. putida 34, and showed another different extra residue R55V N37K, respectively (Fig. 5).

Fig. 5.

Sequence alignment of the partial mercuric reductase protein MerA from 8 isolates with E. cloacae (MerA EU081910). Different residues from the consensus are showed by one letter. Conserved residues are represented by points.

Same different residues like in P. alcaligenes 19 and P. putida 34 except for one residue S1A was detected in Alcaligenes eutrophus 22.

Discussion

In order to investigate the spread and emergence of environmental bacteria resistant to heavy metals in contaminated waters, we studied the heavy metal-resistant phenotype and selected marker genes for resistance to silver, mercury, and copper. In addition, we scored antibiotic resistance to evaluate the impact of heavy metal contamination as a selective agent in the spreading of antibiotic resistance. The heavy metals in the collected contaminated waters from ten sites over Tunisia mainly originated from anthropogenic activities. Sites I, II, and III, located near and surround the Lagoon of Bizerte, were subjected to urban and agricultural pollutions. As described by (Dellali et al. 2001), agricultural origin wastes reach the lagoon due to leaching of inland cultivated and devoted to cereal activities (Banni et al. 2009). With the thirteen isolates collected from Sites I, II, and III, the highest resistance was recorded for silver; 100% of isolates showed the high MIC values for Ag+ ranging from 0.032 to 0.064 mM, and harbored the silE gene in the same time.

Prevalence of multidrug-resistant bacteria in the North of Tunisia. Ten resistant isolates from Sites I, II, and III harbored the CusA efflux pump. The cusA gene was found in 84.6% of the isolates in I, II, and III Sites. All of these isolates showed high MICs of copper ranging from 3 to 6 mM, except for only one isolate, which was able to grow in a concentration of 1.5 mM, and harbored the gene simultaneously. The contents of copper of the superficial sediments of the Lagoon of Bizerte suggested by (Dellali et al. 2001), (Ouakad et al. 2007), and (Ben Garali et al. 2010) showed a remarkable increase of the concentrations 45 parts-per-million (ppm), 58 ppm, and 67 ppM respectively. These values are beyond the admissible limit of the National Network of Observation (RNO 2007) with 30 ppm, and therefore, they are considered contaminated. Those results can explain the high level of resistance against copper, shown by isolates from this work.

On the other hand, we found the merA gene in only 46.15% of the isolates that could grow in concentrations higher than 0.04 mM. This low resistance against mercury can be explained by the low concentration of mercury in the lagoon and surrounding areas, such as Bizerte, Menzel Bourguiba (0.41 ppm) (Mzoughi et al. 2002).

Data recorded in Essijoumi Lagoon showed that 50% of isolates collected in this site harbored the cusA gene and were able to grow until a concentration of Cu ranged from 3 to 6 mM. The copper concentration recorded in this site corresponds to a high concentration (359 ppm) (Marzougui and Ben Mammou 2006); it is much higher than the critical values given by the European norm (30 ppm) (Rademacher 2001). Moreover, 75% of the isolates for which the MIC values of Ag+ were above 0.032 mM, harbored the silE gene. (Zhang et al. 2019) reported that copper ions (Cu2+) could stimulate the conjugative transfer of silver via resistance nodulation-cell division (RND-type) Ag+/Cu+ efflux transporter that exports Ag+/Cu+ from the periplasm via an antiport (Randall et al. 2015).

No data in the literature evokes the contamination of this site by mercury. Nevertheless, 100% of isolates in this site harbored the merA gene with the high MIC value between 0.04 and 0.08 mM. Those high values are considered as the first values reported in the literature.

Site VI and VII are located on the west coast of Tunis’s gulf and exposed to heavy metals, mainly transported to the marine environment (Ben Amor et al. 2019). The geoaccumulation index value for copper (10 ppm) recorded by (Ben Amor et al. 2019) has indicated that all samples were uncontaminated. Those results explained in the present work, the lowest proportion (20%) of isolates that harbored the cusA gene, while 83% and 60% of them showed resistance to silver and mercury, respectively.

Trace heavy metal, like mercury, is among the most severe pollutants in nature due to its toxicity. Luckily, it was reported by (Ennouri et al. 2008) at a very low concentration (0.33 ppm) in the Lebna River (Site VIII). Regarding Hg, the concentrations are relatively low. It may be why isolates did not develop any resistance, especially that we did not detect the merA gene among our isolates. The metal at a concentration of only 0.005 mM could have inhibited their growth.

Prevalence of multidrug-resistant bacteria in South of Tunisia. The lowest (20%) and the highest (100%) percentages of the resistant isolates against copper and silver, respectively, were collected from Gafsa (Site IX). Copper inhibited the growth of 20% of isolates at a concentration of 3 mM. Site IX was exposed to a high degree of phosphoric and heavy metals contamination due to the anthropogenic activities i.e., mining, manufacturing, and the use of synthetic products (Mekki and Sayedi 2017). It can explain why growth was inhibited for all isolates at a high silver nitrate concentration starting from 0.032 up to 0.064 mM, and that 60% of isolates harbored merA to resist the mercury presence. They were able to grow in the presence of Hg+ at a concentration of 0.08 mM.

The leading cause of contamination of waters in Gabes (Site X) is the acidic industrial effluent that originated from the phosphate treatment factory. Effluents contain phosphogypsum particles and cause ecological risk to marine organisms and human health (Naifar et al. 2018). 75% of isolates from Gabes harbored the cusA gene with the MIC value for copper of 3 mM. When we compare our results with (Naifar et al. 2018) results, we could say that the copper concentration of 0.5 ppm is lower than Tunisian standards (1.5 ppm). It can stimulate the resistance against copper with high MICs. The co-stimulation may explain those results by other heavy metals present with high concentrations, i.e., iron (16 ppm) and Zn (18 ppm). Both values exceeded the Tunisian standards (1 ppm) and (10 ppm), respectively.

The present study provided new information about silver contamination, notably the highest resistance in the ten sites was recorded to silver. The silE gene was harbored by 36 isolates (92.30%) of the total 39 isolates. Moreover, the silver resistance prevalence was higher than those observed by (Edwards-Jones 2009), who recorded only 3.5% isolates possessing the silver resistance genes silE of 172 bacterial isolates from wounds. The considerable difference between these studies may be explained by the fact that the environment always brings the most significant risk of being exposed to HM contamination.

Molecular analysis of multi-drug resistance. The latter encodes the extracellular heavy metal-binding protein (periplasmic space) SilE. Observed amino acid sequence variations did not concern conserved histidine and methionine residues nor the Ag+ binding motif characteristic to SilE, described by (Asiani et al. 2016). It allowed the corresponding isolate to maintain its ability to resist silver presence by producing an active SilE, and conserved the protein functionality in absorbing heavy metal ions. These results confirmed again that mutations observed here had no impact on the MIC value of silver.

(Long et al. 2010) suggest a crystal structure of the CusA efflux pump methionine mediated CuI but also AgI heavy metal transport. The cusA gene was harbored by 43.4% of our isolates.

The heavy metal binding-sites are formed by three methionines (M573, M623, and M672) and found above this horizontal helix (Long et al. 2010). The partial sequence aligned with consensus started from AA149 to AA280 with conserved M230 and M271. The latter is one of the four channel pairs, which includes the four methionine pairs (M410 and M501, M403 and M486, M391 and M1009, and M271 and M755) as well as the heavy metal binding-sites formed by the three methionines, facilitating heavy metal transport. The mutations that affected the other residues, which did not touch the heavy metal binding-sites or the channel, conserved their functionality in absorbing AgI and CuI ions.

The mercury reductase MerA is known as an enzyme, reducing the ionic mercury Hg (II) to elemental mercury. In bacteria, the mercury resistance is specified by operon (mer) that can transport Hg (II) and organo-mercury to the cytosol for degradation and reduction to Hg (0). MerA catalase, a flavin oxidoreductase, reduces Hg (II) to NAD(P)H dependent reaction. MerA or mercury reductase can play an important role in the biogeochemical cycling of mercury in contaminated environments by partitioning mercury to the atmosphere (Ní Chadhain et al. 2006).

The MerA amino acid sequences’ multiple alignments in the present study revealed a minor difference in sequence patterns between our MerA protein isolates and the consensus (Fig. 5). Thus, the partial MerA sequence did not contain both motifs. Despite the few mutations, mercuric reductase from our resistant isolates retained the ability to reduce mercury. We suppose that FAD/NADP and mercury binding sites were well conserved in our eight resistant isolates. Among 51.2% of mercury-resistant isolates, which detected the merA gene, only 20% of them expressed the MerA protein; however, the remaining isolates expressed ABC Transporter, TeTR family, ATP-ase super-family, and ATP binding family.

Molecular aspects of cross-resistance. To better understand the bacterial cross-resistance and its ecological risk, it was essential to elucidate the bacterial resistance against heavy metals and antibiotics.

The overuse of antibiotics in clinics and hospitals raises the emergence of resistant bacteria. Environmental bacteria, especially, showed resistance to antibiotics, which were detected in different environmental compartments such as soils, surface water, sediments ground water, and waste-water (Kümmerer 2004).

In the present study, the environmental strains isolated from the ten sites showed high resistance to a large number of antibiotics, and some were even ESBLs and MBLs-producers, which is a global health concern. This ubiquitous detection of antibiotic resistance and resistant genes in isolates indicates the emergence of antibiotic-resistant strains in the golf of Tunis and Gulf of Gabes, which threatens the health of animals and people throughout Tunisia.

Substantial reports suggest that heavy metal contamination represents an indirect selection agent that contributes to the maintenance and spread of antibiotic resistance factors (Baker-Austin et al. 2006). The silE gene can be harbored on plasmids (Ben Miloud et al. 2020) carrying antibiotic resistance genes, and silver can thereby have an indirect selective pressure. Even more directly, silver can select for porin deficiency and consequently mediate a cross-resistance to β-lactams (Sütterlin et al. 2014). In addition, contamination by heavy metals such as cadmium, zinc, copper, and mercury affected soil or water environment, besides they are toxic to bacteria. They also initiate the co-selection of antibiotic resistance using different mechanisms, i.e., agricultural soils amended with copper co-select resistance to ampicillin, chloramphenicol, and tetracycline (Oves and Hussain 2016).

Conclusion

It is the first work describing contaminations by copper, silver, and mercury in ten sites in Tunisia. Such data were almost absent in the literature. Moreover, a high degree of heavy metal and antibiotic resistance were found in our isolates. They develop some new mechanisms to eliminate or reduce heavy metals or antibiotics’ impact.

The resistant environmental bacteria in Tunisia are more prevalent than we expected for both antibiotic and heavy metal resistance. The cross-resistance between them made the bacteria better fitted to the environment. It also enhances the danger and the risk of public health. Even though the detailed mechanisms of cross-resistance are unclear, it will be recommended to study the impact of heavy metals on antibiotic resistance in environmental microorganisms. With the extent of pollution, it is valid to study the co-existence of antibiotics and heavy metal resistance and their particular influence on bacteria.

Fig. 1.

Phylogenetic tree based on the partial 16S rRNA gene sequences of the 39 isolates. Ten colors used to distinguish ten different sampling sites classified from north to south of Tunisia: Dark blue: Menzel Jemil; Orange: Iron factory; Red: Tinjahwedi Bizerte; Cyan: Collector between wastewater treatment plant (CWTP) of Beja; Green: Marsh Sejoumi; Yellow: Milian Rades Wedi; Light purple: Majerda River; Pink: Lebnawedi Cap Bon; Dark purple: Om Larayes Gafsa; Grey: Golf of Gabes.
Phylogenetic tree based on the partial 16S rRNA gene sequences of the 39 isolates. Ten colors used to distinguish ten different sampling sites classified from north to south of Tunisia: Dark blue: Menzel Jemil; Orange: Iron factory; Red: Tinjahwedi Bizerte; Cyan: Collector between wastewater treatment plant (CWTP) of Beja; Green: Marsh Sejoumi; Yellow: Milian Rades Wedi; Light purple: Majerda River; Pink: Lebnawedi Cap Bon; Dark purple: Om Larayes Gafsa; Grey: Golf of Gabes.

Fig. 2.

Detection by PCR of heavy metal resistance genes.a – Amplicon of silE of Enterobacter cloacae 27 (400 bp);b – Amplicon of cusA of Klebsiella pneumoniae 13 (410 bp);c – Amplicon of merA of Pseudomonas putida 26 (285 bp);M – Size Marker 1 kb Plus.
Detection by PCR of heavy metal resistance genes.a – Amplicon of silE of Enterobacter cloacae 27 (400 bp);b – Amplicon of cusA of Klebsiella pneumoniae 13 (410 bp);c – Amplicon of merA of Pseudomonas putida 26 (285 bp);M – Size Marker 1 kb Plus.

Fig. 3.

Sequence alignment of the partial SilE protein from 39 isolates with SilE from pMG101 (SilE AAD11743). Letters shows res idues different from the consensus. Conserved histidine and methionine residues are marked above with either a circle or a square, respectively.
Sequence alignment of the partial SilE protein from 39 isolates with SilE from pMG101 (SilE AAD11743). Letters shows res idues different from the consensus. Conserved histidine and methionine residues are marked above with either a circle or a square, respectively.

Fig. 4.

Sequence alignment of the partial Cation efflux system protein CusA from 10 isolates with E. coli P30854. Different residues from the consensus are showed by one letter. Conserved residues are represented by points.
Sequence alignment of the partial Cation efflux system protein CusA from 10 isolates with E. coli P30854. Different residues from the consensus are showed by one letter. Conserved residues are represented by points.

Fig. 5.

Sequence alignment of the partial mercuric reductase protein MerA from 8 isolates with E. cloacae (MerA EU081910). Different residues from the consensus are showed by one letter. Conserved residues are represented by points.
Sequence alignment of the partial mercuric reductase protein MerA from 8 isolates with E. cloacae (MerA EU081910). Different residues from the consensus are showed by one letter. Conserved residues are represented by points.

Phenotypic and molecular characteristics of antibiotic and heavy metal resistant isolates collected from polluted water in Tunisia.

StrainsSitesMICs of HM (µg/ml) Ag2+ Cu2+ Hg2+HM resistance genesAB resistance profileAB resistance genes
Pseudomonas anguilliseptica 1MJ. Bizerte0.064 (R) 0.625(S) 0.08 (R)silE, merAAMP, ATM, FOSblaTEM
Alcaligenes eutrophus 2MJ. Bizerte0.064 (R) 3 (R) 0.005 (S)silE, cusAAMP, CAZblaTEM
Escherichia coli. 3MJ. Bizerte0.064 (R) 6 (R) 0.0025 (S)silE, cusAAMP, TIC, PIP, CXM, CFM, CAZ, ATM, GMN, NET, TOB, CTXblaTEM, blaCTX-M-1, qnrB
Staphylococcus aureus 4MJ. Bizerte0.064 (R) 3(R) 0.08 (R)silE, cusA, merAAMP, ATM, FOS, CIP, LEVblaTEM
Pseudomonas mendocina 5IF of Bizerte MB0.032 (R) 3(R) 0.08 (R)silE, cusA, merAAMP, ATM, FOSblaTEM
Alcaligenes eutrophus 6IF of Bizerte MB0.064 (R) 6(R) 0.005 (S)silE, cusAAMP, CAZ, SXT, CHLblaTEM
Klebsiella pneumoniae 7IF of Bizerte MB0.064 (R) 3(R) 0.08 (R)silE, cusA, merAAMP, TIC, FOX, FEP, ETP, AMC, CAZ, IMP, SXT, CTX, FOS, CLS, NOR, CIP, GMN, AKN, NET, TOB, NFE, MNO, TETblaTEM, blaSHV, blaCTX-M-1, blaOX48, qnrB
Pseudomonas putida 8IF of Bizerte MB0.064 (R) 1.5 (S) 0.005 (S)silEAMP, TIC, TCC, PIP, FEP, CAZ, ATM, FOSblaTEM
Alcaligenes faecalis 9IF of Bizerte MB0.064 (R) 3 (R) 0.005 (S)silE, cusAAMP, CAZblaTEM
Pseudomonas mendocina 10Tinjah wedi, Bizerte0.064 (R) 1.5 (S) 0.08 (R)silE, cusA, merAAMP, ATM, FOSblaTEM
Pseudomonas mendocina 11Tinjah wedi, Bizerte0.032 (R) 3 (R) 0.005 (S)silE, cusAAMP, TCC, FOSblaTEM
Alcaligenes faecalis 12Tinjah wedi, Bizerte0.064 (R) 3 (R) 0.005 (S)silE, cusAAMP, CAZ, CHLblaTEM
Klebsiella pneumoniae 13Tinjah wedi, Bizerte0.032 (R) 3 (R) 0.04 (R)silE, cusA, merAAMP, TIC, AMC, NAL, NOR, CHL, TGC, MNO, TETblaTEM, blaSHV
Pseudomonas fluorescens 14CWTP of Beja0.064 (R) 3 (R) 0.005 (S)silE, cusAAMP, TIC, ATM, FOS, IMP, MEM,blaTEM
Pseudomonas putida 15CWTP of Beja0.064 (R) 1.5 (S) 0.08 (R)silE, merAAMP, TIC, TCCblaTEM
Pseudomonas putida 16CWTP of Beja0.008 (S) 3 (R) 0.04 (R)cusA, merAAMP, TIC, TCC, PIP, FEP, CAZ, ATM, FOSblaTEM
Aeromonas salmonicida 17Marsh Sejoumi0.032 (R) 1.5 (S) 0.08 (R)silE, merAAMP, TICblaTEM
Alcaligenes eutrophus 18Marsh Sejoumi0.008 (S) 0.625 (S) 0.08 (R)merAAMP, CAZblaTEM
Pseudomonas alcaligenes 19Marsh Sejoumi0.0064(R) 3 (R) 0.08 (R)silE, cusA, merAAMP, TIC, PIP, TCC, FOSblaTEM
Enterobacter cloacae 20Marsh Sejoumi0.064 (R) 6 (R) 0.08 (R)silE, cusA, merAAMP, TIC, FOX, AMC, CTXblaTEM, blaOXA-1, blaSHV, blaCTX-M-9
Bacillus coagulans 21Milian Rades Wedi0.064 (R) 3 (R) 0.02 (R)silE, cusA, merAAMP, TIC, TCC, PIP, FEP, CAZ, ATM, FOSblaTEM
Alcaligenes eutrophus 22Milian Rades Wedi0.064 (R) 0.625 (S) 0.08 (R)silE, merAAMP, CAZ, SXT, CHLblaTEM
Pseudomonas putida 23Milian Rades Wedi0.004 (S) 0.625 (S) 0.005 (S)AMP, ATM, FOSblaTEM, blaSHV
Alcaligenes eutrophus 24Majerda River0.064 (R) 1.5 (S) 0.005 (S)silEAMP, CAZblaTEM
Serratia marcescens 25Majerda River0.064 (R) 1.5 (S) 0.02 (R)silE, merAAMP, TIC, FOX, AMCblaTEM, blaOXA-1, blaSHV
Pseudomonas putida 26Majerda River0.032 (R) 0.75 (S) 0.02 (R)silE, merAAMP, FOS, ATM, LEVblaTEM
Enterobacter cloacae 27Lebna wedi C.B0.064 (R) 3 (R) 0.005 (S)silE, cusAAMP, TIC, FOX, AMC, TGC, MNO, TETblaTEM, blaOXA-1
Serratia fonticola 28Lebna wedi C.B0.064 (R) 1.5 (S) 0.005 (S)silEAMP, TIC, AMC, CTX, CLSblaTEM, blaCTX-M-9
Alcaligenes faecalis 29Lebna wedi C.B0.032 (R) 3 (R) 0.005 (S)silE, cusAAMP, CAZblaTEM
Klebsiella pneumoniae 30Lebna wedi C.B0.064 (R) 6 (R) 0.005 (S)silE, cusAAMP, TIC, AMCblaTEM, blaSHV
Pseudomonas fluorescens 31Om Larayes, Gafsa0.064 (R) 3 (R) 0.08 (R)silE, cusA, merAAMP, TIC, TCC, PIP, FEP, ATM, IMP, MEM, FOSblaTEM
Aeromonas salmonicida 32Om Larayes, Gafsa0.064 (R) 0.625(S) 0.005 (S)silEAMPblaTEM
Aeromonas salmonicida 33Om Larayes, Gafsa0.064 (R) 1.5 (S) 0.08 (R)silE, merAAMP, TIC, FEP, CAZ, ATMblaTEM
Pseudomonas putida 34Om Larayes, Gafsa0.032 (R) 1.5 (S) 0.08 (R)silE, merAAMP, TIC, TCC, PIP, TZP, CAZ, ATMblaTEM
Pseudomonas fluorescens 35Om Larayes, Gafsa0.0064 (R) 0.75 (S) 0.005 (S)silEAMP, TIC, TCC, ATM, MEMblaTEM
Pseudomonas putida 36Gulf of Gabes0.064 (R) 3 (R) 0.008 (S)silE, cusAAMP, TIC, TCC, PIP, TZP, ATM, MEMblaTEM
Serratia marcescens 37Gulf of Gabes0.064 (R) 1.5 (S) 0.005 (S)silEAMP, FOX, AMC, TGC, MNO, TETblaTEM
Pseudomonas fluorescens 38Gulf of Gabes0.0064 (R) 6 (R) 0.08 (R)silE, cusA, merAAMP, TIC, TCC, PIP, TZP, FEP, CAZ, ATM, MEM, LEV, FOSblaTEM
Klebsiella pneumoniae 39Gulf of Gabes0.032 (R) 3 (R) 0.0025 (S)silE, cusAAMP, TIC, TCC, PIP, CFN, CXM, CFM, CAZ, FEP, ATM, GMN, NET, TOBblaSHV, blaCTX-M-1, qnrB

Primers, expected fragment size, and conditions of PCR experiments used for quinolones resistance encoding genes.

MultiplexTargetSequence of primer (5′–3′)Size (bp)Amplification conditions
3qnrAqnrA_FCAGCAAGAGGATTTCTCACG63095°C 15 min 94°C 30 sec 63°C 40 sec 30 cycles 72°C 90 sec 72°C 10 min
qnrA_RAATCCGGCAGCACTATTACTC
qnrBqnrB_FGGCTGTCAGTTCTATGATCG488
qnrB_RGAGCAACGATGCCTGGTAG
qnrCqnrC_FGCAGAATTCAGGGGTGTGAT118
qnrC_RAACTGCTCCAAAAGCTGCTC
qnrDqnrD_FCGAGATCAATTTACGGGGAATA581
qnrD_RAACAAGCTGAAGCGCCTG
qnrSqnrS_FGCAAGTTCATTGAACAGGGT428
qnrS_RTCTAAACCGTCGAGTTCGGCG

Sampling sites characteristics, locations, and their corresponding geographic coordinates.

Sites/numerationGeographic coordinatesLocationCharacteristics
Menzel Jemil, Bizerte: Site I37°14′19″N,9°54′59″EIndustrial areaWaste and contamination from the textile industry and wiring throwing inside the Bizerte lagoon
Menzel Bourguiba, Bizerte: Site II37°09′N, 9°47′EUnit manufacturing printed circuits. In the Iron factoryContamination by HM from the iron factory in the Bizerte lagoon. Urban and agricultural pollution
Tinjah wedi, Bizerte: Site III37°10′N, 9°45′ENear the lagoon of BizerteAgricultural pollution and compost contamination.
Beja: Site IV36°43′30″N,9°10′55″ESouthwest of the city of Tunis Near the CWTP*Urban and industrial area, the most known are wastewater and yeast factory
Essijoumi Lagoon: Site V36°45′52″N,10°08′49″EContribution in the Gulf of TunisLagoon receiving contamination from wastewater contamination and wastes from the capital Tunis.
Rades Milian River: Site VI36°46′N,10°17′EIndustrial zone of RadesHigh load alluvial estimated at 25 grams per liter. Receiving wastewater from two towns Rades and Ezzahra.
Majerda River: Site VII37°7′0″N,10°13′0″EA peninsula in far north-eastern TunisiaUsed for irrigation of the region’s agriculture
Lebna River: Site VIII36°45′N,10°54′EInlet manifold sewage treatment plantAgricultural coastal Plans can be found in the area of Cap Bon
Om Larayes, Gafsa: Site IX34°28′59″N,8°16′01″EThe industrial platforms of phosphgyps activityOne of the known mining towns in Gafsa
Gulf of Gabes: Site X34°05′37″N,10°26′13″EThe junction between the Eastern and Central BasinKnown by industry for the transformation of merchantable phosphate into Phosphoric Acid (H3PO4) and Chemical Fertilizers

Primers, expected fragment size and conditions of PCR experiments used for β-lactams resistance encoding genes.

MultiplexTargetPrimers sequences (5′–3′)Size (pb)Concentration (pmol/µl)Volume (µl)Amplification conditions
1TEMMultiTSO-T_F CATTTCCGTGTCGCCCTTATTC8000.40.494°C 10 min 94°C 40 sec 60°C 40 sec 30 cycles 72°C 1 min 72°C 7 min
MultiTSO-T_R CGTTCATCCATAGTTGCCTGAC0.40.4
SHVMultiTSO-S_F AGCCGCTTGAGCAAATTAAAC7130.40.4
MultiTSO-S_R ATCCCGCAGATAAATCACCAC0.40.4
OXA-1-likeMultiTSO-O_F GGCACCAGATTCAACTTTCAAG5640.40.4
MultiTSO-O_R GACCCCAAGTTTCCTGTAAGTG0.40.4
2CTX-M group 1MultiCTXMGp1_F TTAGGAARTGTGCCGCTGTA6880.40.4
MultiCTXMGp1_R CGATATCGTTGGTGGTCCCAT0.20.2
CTX-M group 2MultiCTXMGp2_F CGTTAACGGCACGATGAC4040.20.2
MultiCTXMGp1_R CGATATCGTTGGTGGTTCCAT0.20.2
CTX-M group 9MultiCTXMGp9_F TCAAGCCTGCCGATCTGGT5610.40.4
MultiCTXMGp9_R TGATTCTCGCCGCTGAAG0.40.4
CTX-M group 8CTX-Mg8/25_F AACTCCCAGACGCTCTAC3260.40.4
CTX-Mg8/25_R TCGAGCCGGAASGTGTAAT0.40.4

Aminov RI. Horizontal gene exchange in environmental microbiota. Front Microbiol. 2011 Jul 26;2:158. https://doi.org/10.3389/fmicb.2011.00158AminovRI. Horizontal gene exchange in environmental microbiota. Front Microbiol. 2011Jul26;2:158. https://doi.org/10.3389/fmicb.2011.0015810.3389/fmicb.2011.00158314525721845185Search in Google Scholar

Asiani KR, Williams H, Bird L, Jenner M, Searle MS, Hobman JL, Scott DJ, Soultanas P. SilE is an intrinsically disordered periplasmic “molecular sponge” involved in bacterial silver resistance. Mol Microbiol. 2016 Sep;101(5):731–742. https://doi.org/10.1111/mmi.13399AsianiKRWilliamsHBirdLJennerMSearleMSHobmanJLScottDJSoultanasP. SilE is an intrinsically disordered periplasmic “molecular sponge” involved in bacterial silver resistance. Mol Microbiol. 2016Sep;101(5):731742. https://doi.org/10.1111/mmi.1339910.1111/mmi.13399500810927085056Search in Google Scholar

Baker-Austin C, Wright MS, Stepanauskas R, McArthur JV. Co-selection of antibiotic and metal resistance. Trends Microbiol. 2006 Apr;14(4):176–182. https://doi.org/10.1016/j.tim.2006.02.006Baker-AustinCWrightMSStepanauskasRMcArthurJV. Co-selection of antibiotic and metal resistance. Trends Microbiol. 2006Apr;14(4):176182. https://doi.org/10.1016/j.tim.2006.02.00610.1016/j.tim.2006.02.00616537105Search in Google Scholar

Banni M, Bouraoui Z, Ghedira J, Clearandeau C, Jebali J, Boussetta H. Seasonal variation of oxidative stress biomarkers in clams Ruditapes decussatus sampled from Tunisian coastal areas. Environ Monit Assess. 2009 Aug;155(1-4):119–128. https://doi.org/10.1007/s10661-008-0422-3BanniMBouraouiZGhediraJClearandeauCJebaliJBoussettaH. Seasonal variation of oxidative stress biomarkers in clams Ruditapes decussatus sampled from Tunisian coastal areas. Environ Monit Assess. 2009Aug;155(1-4):119128. https://doi.org/10.1007/s10661-008-0422-310.1007/s10661-008-0422-318594996Search in Google Scholar

Ben Amor R, Yahyaoui A, Abidi M, Chouba L, Gueddari M. Bioavailability and assessment of metal contamination in surface sediments of Rades-Hamam Lif Coast, around Meliane River (Gulf of Tunis, Tunisia, Mediterranean Sea). J Chem. 2019 Apr 15;2019:1–11. https://doi.org/10.1155/2019/4284987Ben AmorRYahyaouiAAbidiMChoubaLGueddariM. Bioavailability and assessment of metal contamination in surface sediments of Rades-Hamam Lif Coast, around Meliane River (Gulf of Tunis, Tunisia, Mediterranean Sea). J Chem. 2019Apr15;2019:111. https://doi.org/10.1155/2019/428498710.1155/2019/4284987Search in Google Scholar

Ben Garali A, Ouakad M, Gueddari M. Contamination of superficial sediments by heavy metals and iron in the Bizerte lagoon, northern Tunisia. Arab J Geosci. 2010;3:295–306. https://doi.org/10.1007/s12517-009-0082-9Ben GaraliAOuakadMGueddariM. Contamination of superficial sediments by heavy metals and iron in the Bizerte lagoon, northern Tunisia. Arab J Geosci. 2010;3:295306. https://doi.org/10.1007/s12517-009-0082-910.1007/s12517-009-0082-9Search in Google Scholar

Ben Miloud S, Ali Md Muntasir, Boutiba I, Van Houdt R, Chouchani C. First report of cross resistance to silver and antibiotics in Klebsiella pneumoniae isolated from patients and polluted water in Tunisia. Water and Enviro J. 2020;0:1–10. https://doi.org/10.1111/wej.12665Ben MiloudSAli MdMuntasirBoutibaIVan HoudtRChouchaniC. First report of cross resistance to silver and antibiotics in Klebsiella pneumoniae isolated from patients and polluted water in Tunisia. Water and Enviro J. 2020;0:110. https://doi.org/10.1111/wej.1266510.1111/wej.12665Search in Google Scholar

Besaury L, Bodilis J, Delgas F, Andrade S, De la Iglesia R, Ouddane B, Quillet L. Abundance and diversity of copper resistance genes cusA and copA in microbial communities in relation to the impact of copper on Chilean marine sediments. Mar Pollut Bull. 2013 Feb;67(1-2):16–25. https://doi.org/10.1016/j.marpolbul.2012.12.007BesauryLBodilisJDelgasFAndradeSDe la IglesiaROuddaneBQuilletL. Abundance and diversity of copper resistance genes cusA and copA in microbial communities in relation to the impact of copper on Chilean marine sediments. Mar Pollut Bull. 2013Feb;67(1-2):1625. https://doi.org/10.1016/j.marpolbul.2012.12.00710.1016/j.marpolbul.2012.12.00723298430Search in Google Scholar

Boyd ES, Barkay T. The mercury resistance operon: from an origin in a geothermal environment to an efficient detoxification machine. Front Microbiol. 2012;3:349. https://doi.org/10.3389/fmicb.2012.00349BoydESBarkayT. The mercury resistance operon: from an origin in a geothermal environment to an efficient detoxification machine. Front Microbiol. 2012;3:349. https://doi.org/10.3389/fmicb.2012.0034910.3389/fmicb.2012.00349346656623087676Search in Google Scholar

Chihomvu P, Stegmann P, Pillay M. Characterization and structure prediction of partial length protein sequences of pcoA, pcoR and chrB genes from heavy metal resistant bacteria from the Klip River, South Africa. Int J Mol Sci. 2015 Apr 01;16(12):7352–7374. https://doi.org/10.3390/ijms16047352ChihomvuPStegmannPPillayM. Characterization and structure prediction of partial length protein sequences of pcoApcoR and chrB genes from heavy metal resistant bacteria from the Klip River, South Africa. Int J Mol Sci. 2015Apr01;16(12):73527374. https://doi.org/10.3390/ijms1604735210.3390/ijms16047352442502125837632Search in Google Scholar

CLSI. M100-S23 performance standards for antimicrobial susceptibility testing. Twenty-third informational supplement. Wayne (USA): Clinical and Laboratory Standards Institute; 2013.CLSI. M100-S23 performance standards for antimicrobial susceptibility testing. Twenty-third informational supplement. Wayne (USA): Clinical and Laboratory Standards Institute; 2013.Search in Google Scholar

Dallenne C, Da Costa A, Decré D, Favier C, Arlet G. Development of a set of multiplex PCR assays for the detection of genes encoding important β-lactamases in Enterobacteriaceae. J Antimicrob Chemother. 2010 Mar;65(3):490–495. https://doi.org/10.1093/jac/dkp498DallenneCDa CostaADecréDFavierCArletG. Development of a set of multiplex PCR assays for the detection of genes encoding important β-lactamases in Enterobacteriaceae. J Antimicrob Chemother. 2010Mar;65(3):490495. https://doi.org/10.1093/jac/dkp49810.1093/jac/dkp498Search in Google Scholar

Dellali M, Gnassia Barelli M, Romeo M, Aissa P. The use of acetylcholinesterase activity in Ruditapes decussatus and Mytilus galloprovincialis in the biomonitoring of Bizerta lagoon. Comp Biochem Physiol C Toxicol Pharmacol. 2001 Oct;130(2):227–235. https://doi.org/10.1016/S1532-0456(01)00245-9DellaliMGnassia BarelliMRomeoMAissaP. The use of acetylcholinesterase activity in Ruditapes decussatus and Mytilus galloprovincialis in the biomonitoring of Bizerta lagoon. Comp Biochem Physiol C Toxicol Pharmacol. 2001Oct;130(2):227235. https://doi.org/10.1016/S1532-0456(01)00245-910.1016/S1532-0456(01)00245-9Search in Google Scholar

Edwards-Jones V. The benefits of silver in hygiene, personal care and healthcare. Lett Appl Microbiol. 2009 Aug;49(2):147–152. https://doi.org/10.1111/j.1472-765X.2009.02648.xEdwards-JonesV. The benefits of silver in hygiene, personal care and healthcare. Lett Appl Microbiol. 2009Aug;49(2):147152. https://doi.org/10.1111/j.1472-765X.2009.02648.x10.1111/j.1472-765X.2009.02648.xSearch in Google Scholar

Ennouri R, Chouba L, Kraiem MM. [Evaluation de la contamination chimique par les métaux traces (Cd, Pb, Hg et Zn) du zooplanctoon et de la sardinelle (Sardinella aurita) dans le golfe de Tunis] (in French). Bull. Inst. Nat. Scien. Tech. Mer de salambo. 2008;35:87–94.EnnouriRChoubaLKraiemMM. [Evaluation de la contamination chimique par les métaux traces (Cd, Pb, Hg et Zn) du zooplanctoon et de la sardinelle (Sardinella aurita) dans le golfe de Tunis] (in French). Bull. Inst. Nat. Scien. Tech. Mer de salambo. 2008;35:8794.Search in Google Scholar

Fatimawali, Kepel B, Yusuf I, Badaruddin F, Natsir R, Retnoningrum D. Isolation and characterization of partial sequence of merA gene from mercury resistant bacterium Klebsiella pneumoniae isolated from Sario River Estuary Manado. J Environ Earth Sci. 2014; 6(3):156–160. https://doi.org/10.19026/rjees.6.5754FatimawaliKepelBYusufIBadaruddinFNatsirRRetnoningrumD. Isolation and characterization of partial sequence of merA gene from mercury resistant bacterium Klebsiella pneumoniae isolated from Sario River Estuary Manado. J Environ Earth Sci. 2014; 6(3):156160. https://doi.org/10.19026/rjees.6.575410.19026/rjees.6.5754Search in Google Scholar

Filali BK, Taoufik J, Zeroual Y, Dzairi FZ, Talbi M, Blaghen M. Waste water bacterial isolates resistant to heavy metals and antibiotics. Curr Microbiol. 2000 Sep;41(3):151–156. https://doi.org/10.1007/s0028400FilaliBKTaoufikJZeroualYDzairiFZTalbiMBlaghenM. Waste water bacterial isolates resistant to heavy metals and antibiotics. Curr Microbiol. 2000Sep;41(3):151156. https://doi.org/10.1007/s002840010.1007/s0028400Search in Google Scholar

Galkiewicz JP, Kellogg CA. Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology. Appl Environ Microbiol. 2008 Dec 15;74(24):7828–7831. https://doi.org/10.1128/AEM.01303-08GalkiewiczJPKelloggCA. Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology. Appl Environ Microbiol. 2008Dec15;74(24):78287831. https://doi.org/10.1128/AEM.01303-0810.1128/AEM.01303-08Search in Google Scholar

Gupta A, Matsui K, Lo JF, Silver S. Molecular basis for resistance to silver cations in Salmonella. Nat Med. 1999 Feb;5(2):183–188. https://doi.org/10.1038/5545GuptaAMatsuiKLoJFSilverS. Molecular basis for resistance to silver cations in Salmonella. Nat Med. 1999Feb;5(2):183188. https://doi.org/10.1038/554510.1038/5545Search in Google Scholar

Harrison M, Jones C, Solioz M, Dameron C. Intracellular copper routing: the role of copper chaperones. Trends Biochem Sci. 2000 Jan 01;25(1):29–32. https://doi.org/10.1016/S0968-0004(99)01492-9HarrisonMJonesCSoliozMDameronC. Intracellular copper routing: the role of copper chaperones. Trends Biochem Sci. 2000Jan01;25(1):2932. https://doi.org/10.1016/S0968-0004(99)01492-910.1016/S0968-0004(99)01492-9Search in Google Scholar

Jan AT, Murtaza I, Ali A, Rizwanul Haq QM. Mercury pollution: an emerging problem and potential bacterial remediation strategies. World J Microbiol Biotechnol. 2009 Sep;25(9):1529–1537. https://doi.org/10.1007/s11274-009-0050-2JanATMurtazaIAliARizwanul HaqQM. Mercury pollution: an emerging problem and potential bacterial remediation strategies. World J Microbiol Biotechnol. 2009Sep;25(9):15291537. https://doi.org/10.1007/s11274-009-0050-210.1007/s11274-009-0050-2Search in Google Scholar

Jung WK, Koo HC, Kim KW, Shin S, Kim SH, Park YH. Antibacterial activity and mechanism of action of the silver ion in Staphylococcus aureus and Escherichia coli. Appl Environ Microbiol. 2008 Apr 01;74(7):2171–2178. https://doi.org/10.1128/AEM.02001-07JungWKKooHCKimKWShinSKimSHParkYH. Antibacterial activity and mechanism of action of the silver ion in Staphylococcus aureus and Escherichia coli. Appl Environ Microbiol. 2008Apr01;74(7):21712178. https://doi.org/10.1128/AEM.02001-0710.1128/AEM.02001-07229260018245232Search in Google Scholar

Kerfoot WC, Harting SL, Jeong J, Robbins JA, Rossmann R. Local, regional, and global implications of elemental mercury in metal (copper, silver, gold, and zinc) ores: insights from Lake Superior sediments. J Great Lakes Res. 2004 Jan;30:162–184. https://doi.org/10.1016/S0380-1330(04)70384-6KerfootWCHartingSLJeongJRobbinsJARossmannR. Local, regional, and global implications of elemental mercury in metal (copper, silver, gold, and zinc) ores: insights from Lake Superior sediments. J Great Lakes Res. 2004Jan;30:162184. https://doi.org/10.1016/S0380-1330(04)70384-610.1016/S0380-1330(04)70384-6Search in Google Scholar

Kerfoot WC, Harting, SL, Rossmann, R, Robbins, JA. Elemental mercury in copper, silver and gold ores: an unexpected contribution to Lake Superior sediments with global implications. Geochem Explor Environ Anal. 2002 May;2(2):185–202. https://doi.org/10.1144/1467-787302-022KerfootWCHartingSLRossmannRRobbinsJA. Elemental mercury in copper, silver and gold ores: an unexpected contribution to Lake Superior sediments with global implications. Geochem Explor Environ Anal. 2002May;2(2):185202. https://doi.org/10.1144/1467-787302-02210.1144/1467-787302-022Search in Google Scholar

Kershaw CJ, Brown NL, Constantinidou C, Patel MD, Hobman JL. The expression profile of Escherichia coli K-12 in response to minimal, optimal and excess copper concentrations. Microbiology. 2005 Apr 01;151(4):1187–1198. https://doi.org/10.1099/mic.0.27650-0KershawCJBrownNLConstantinidouCPatelMDHobmanJL. The expression profile of Escherichia coli K-12 in response to minimal, optimal and excess copper concentrations. Microbiology. 2005Apr01;151(4):11871198. https://doi.org/10.1099/mic.0.27650-010.1099/mic.0.27650-0Search in Google Scholar

Klasen HJ. Historical review of the use of silver in the treatment of burns. I. Early uses. Burns. 2000 Mar;26(2):117–130. https://doi.org/10.1016/S0305-4179(99)00108-4KlasenHJ. Historical review of the use of silver in the treatment of burns. I. Early uses. Burns. 2000Mar;26(2):117130. https://doi.org/10.1016/S0305-4179(99)00108-410.1016/S0305-4179(99)00108-4Search in Google Scholar

Kumar S, Stecher G, Tamura K. MEGA 7: molecular Evolutionary Genetics Analysis version 7.0 for bigger datastes. Mol Biol Evol. 2016 Jul;33(7):1870–1874. https://doi.org/10.1093/molbev/msw054KumarSStecherGTamuraK. MEGA 7: molecular Evolutionary Genetics Analysis version 7.0 for bigger datastes. Mol Biol Evol. 2016Jul;33(7):18701874. https://doi.org/10.1093/molbev/msw05410.1093/molbev/msw054821082327004904Search in Google Scholar

Kümmerer K. Resistance in the environment. J Antimicrob Chemother. 2004 Jul 01;54(2):311–320. https://doi.org/10.1093/jac/dkh325KümmererK. Resistance in the environment. J Antimicrob Chemother. 2004Jul01;54(2):311320. https://doi.org/10.1093/jac/dkh32510.1093/jac/dkh32515215223Search in Google Scholar

Long F, Su CC, Zimmermann MT, Boyken SE, Rajashankar KR, Jernigan RL, Yu EW. Crystal structures of the CusA efflux pump suggest methionine-mediated metal transport. Nature. 2010 Sep; 467(7314):484–488. https://doi.org/10.1038/nature09395LongFSuCCZimmermannMTBoykenSERajashankarKRJerniganRLYuEW. Crystal structures of the CusA efflux pump suggest methionine-mediated metal transport. Nature. 2010Sep; 467(7314):484488. https://doi.org/10.1038/nature0939510.1038/nature09395294609020865003Search in Google Scholar

Mandal S, Nath Das S, Mandal M. Plasmid mediated antibiotic and heavy metal co-resistance in bacterial isolates from Mahananda River water (Malda, India). Transl Med (Sunnyvale). 2016;06(04):185. https://doi.org/10.4172/2161-1025.1000185MandalSNath DasSMandalM. Plasmid mediated antibiotic and heavy metal co-resistance in bacterial isolates from Mahananda River water (Malda, India). Transl Med (Sunnyvale). 2016;06(04):185. https://doi.org/10.4172/2161-1025.100018510.4172/2161-1025.1000185Search in Google Scholar

Marzougui A, Ben Mammou A. Impacts of the dumping site on the environment: Case of the Henchir El Yahoudia Site, Tunis, Tunisia. C R Geosci. 2006 Dec;338(16):1176–1183. https://doi.org/10.1016/j.crte.2006.09.020MarzouguiABen MammouA. Impacts of the dumping site on the environment: Case of the Henchir El Yahoudia Site, Tunis, Tunisia. C R Geosci. 2006Dec;338(16):11761183. https://doi.org/10.1016/j.crte.2006.09.02010.1016/j.crte.2006.09.020Search in Google Scholar

Mekki A, Sayadi S. Study of heavy metal accumulation and residual toxicity in soil saturated with phosphate processing wastewater. Water Air Soil Pollut. 2017 Jun;228(6):215. https://doi.org/10.1007/s11270-017-3399-0MekkiASayadiS. Study of heavy metal accumulation and residual toxicity in soil saturated with phosphate processing wastewater. Water Air Soil Pollut. 2017Jun;228(6):215. https://doi.org/10.1007/s11270-017-3399-010.1007/s11270-017-3399-0544387628603317Search in Google Scholar

Mergeay M, Nies D, Schlegel HG, Gerits J, Charles P, Van Gijsegem F. Alcaligenes eutrophus CH34 is a facultative chemolithotroph with plasmid-bound resistance to heavy metals. J Bacteriol. 1985; 162(1):328–334. https://doi.org/10.1128/JB.162.1.328-334.1985MergeayMNiesDSchlegelHGGeritsJCharlesPVan GijsegemF. Alcaligenes eutrophus CH34 is a facultative chemolithotroph with plasmid-bound resistance to heavy metals. J Bacteriol. 1985; 162(1):328334. https://doi.org/10.1128/JB.162.1.328-334.198510.1128/jb.162.1.328-334.1985Search in Google Scholar

Monsieurs P, Moors H, Van Houdt R, Janssen PJ, Janssen A, Coninx I, Mergeay M, Leys N. Heavy metal resistance in Cupriavidus metallidurans CH34 is governed by an intricate transcriptional network. Biometals. 2011 Dec;24(6):1133–1151. https://doi.org/10.1007/s10534-011-9473-yMonsieursPMoorsHVan HoudtRJanssenPJJanssenAConinxIMergeayMLeysN. Heavy metal resistance in Cupriavidus metallidurans CH34 is governed by an intricate transcriptional network. Biometals. 2011Dec;24(6):11331151. https://doi.org/10.1007/s10534-011-9473-y10.1007/s10534-011-9473-ySearch in Google Scholar

Mzoughi N, Stoichev T, Dachraoui M, El Abed A, Amouroux D, Donard OFX. Inorganic mercury and methylmercury in surface sediments and mussel tissues from a microtidal lagoon (Bizerte, Tunisia). J Coast Conserv. 2002;8(2):141–145. https://doi.org/10.1652/1400-0350(2002)008[0141:IMAMIS]2.0.CO;2MzoughiNStoichevTDachraouiMEl AbedAAmourouxDDonardOFX. Inorganic mercury and methylmercury in surface sediments and mussel tissues from a microtidal lagoon (Bizerte, Tunisia). J Coast Conserv. 2002;8(2):141145. https://doi.org/10.1652/1400-0350(2002)008[0141:IMAMIS]2.0.CO;210.1652/1400-0350(2002)008[0141:IMAMIS]2.0.CO;2Search in Google Scholar

Naifar I, Pereira F, Zmemla R, Bouaziz M, Elleuch B, Garcia D. Spatial distribution and contamination assessment of heavy metals in marine sediments of the southern coast of Sfax, Gabes Gulf, Tunisia. Mar Pollut Bull. 2018 Jun;131(Pt A):53–62. https://doi.org/10.1016/j.marpolbul.2018.03.048NaifarIPereiraFZmemlaRBouazizMElleuchBGarciaD. Spatial distribution and contamination assessment of heavy metals in marine sediments of the southern coast of Sfax, Gabes Gulf, Tunisia. Mar Pollut Bull. 2018Jun;131(Pt A):5362. https://doi.org/10.1016/j.marpolbul.2018.03.04810.1016/j.marpolbul.2018.03.048Search in Google Scholar

Nguyen CC, Hugie CN, Kile ML, Navab-Daneshmand T. Association between heavy metals and antibiotic-resistant human pathogens in environmental reservoirs: A review. Front Environ Sci Eng. 2019 Jun;13(3):46. https://doi.org/10.1007/s11783-019-1129-0NguyenCCHugieCNKileMLNavab-DaneshmandT. Association between heavy metals and antibiotic-resistant human pathogens in environmental reservoirs: A review. Front Environ Sci Eng. 2019Jun;13(3):46. https://doi.org/10.1007/s11783-019-1129-010.1007/s11783-019-1129-0Search in Google Scholar

Ní Chadhain SM, Schaefer JK, Crane S, Zylstra GJ, Barkay T. Analysis of mercuric reductase (merA) gene diversity in an anaerobic mercury-contaminated sediment enrichment. Environ Microbiol. 2006 Oct;8(10):1746–1752. https://doi.org/10.1111/j.1462-2920.2006.01114.xNí ChadhainSMSchaeferJKCraneSZylstraGJBarkayT. Analysis of mercuric reductase (merA) gene diversity in an anaerobic mercury-contaminated sediment enrichment. Environ Microbiol. 2006Oct;8(10):17461752. https://doi.org/10.1111/j.1462-2920.2006.01114.x10.1111/j.1462-2920.2006.01114.xSearch in Google Scholar

Ouakad M. Genèse et évolution des milieux laguno-lacustres du nord-est de la Tunisie (Garaet Ichkeul, Lagunes de Bizerte et de Ghar el Melh) [Thèse Doct. ès.]. Sciences Géologiques, Université de Tunis el Manar, Tunis, Tunisie. 2007. p. 453.OuakadM. Genèse et évolution des milieux laguno-lacustres du nord-est de la Tunisie (Garaet Ichkeul, Lagunes de Bizerte et de Ghar el Melh) [Thèse Doct. ès.]. Sciences Géologiques, Université de Tunis el Manar, Tunis, Tunisie. 2007. p. 453.Search in Google Scholar

Oves M, Mabood Hussain F. Antibiotics and heavy metal resistance emergence in water borne bacteria. J Invest Genomics. 2016 Sep 28; 3(2):23–25. https://doi.org/10.15406/jig.2016.03.00045OvesMMabood HussainF. Antibiotics and heavy metal resistance emergence in water borne bacteria. J Invest Genomics. 2016Sep28; 3(2):2325. https://doi.org/10.15406/jig.2016.03.0004510.15406/jig.2016.03.00045Search in Google Scholar

Rademacher P. Atmospheric heavy metals and forest ecosystems. Geneva (Switzerland): UN/ECE, Federal Research Centre for Forestry and Forest Products (BFH); 2001. p. 75.RademacherP. Atmospheric heavy metals and forest ecosystems. Geneva (Switzerland): UN/ECE, Federal Research Centre for Forestry and Forest Products (BFH); 2001. p. 75.Search in Google Scholar

Randall CP, Gupta A, Jackson N, Busse D, O’Neill AJ. Silver resistance in Gram-negative bacteria: a dissection of endogenous and exogenous mechanisms. J Antimicrob Chemother. 2015 Jan 06;70(4):1037–1046. https://doi.org/10.1093/jac/dku523RandallCPGuptaAJacksonNBusseDO’NeillAJ. Silver resistance in Gram-negative bacteria: a dissection of endogenous and exogenous mechanisms. J Antimicrob Chemother. 2015Jan06;70(4):10371046. https://doi.org/10.1093/jac/dku52310.1093/jac/dku523Search in Google Scholar

RNO. Tendances temporelles des teneurs en contaminants dans les mollusques du littoral français. Surveillance du Milieu Marin. Édition 2000. Travaux du Réseau National d’Observation de la qualité du milieu marin (RNO). Ifremer et Ministère de l’Aménagement du territoire et de l’Environnement; 2007. p. 9–32.RNO. Tendances temporelles des teneurs en contaminants dans les mollusques du littoral français. Surveillance du Milieu Marin. Édition 2000. Travaux du Réseau National d’Observation de la qualité du milieu marin (RNO). Ifremer et Ministère de l’Aménagement du territoire et de l’Environnement; 2007. p. 932.Search in Google Scholar

Silver S, Phung LT. Bacterial heavy metal resistance: new Surprises. Annu Rev Microbiol. 1996 Oct;50(1):753–789. https://doi.org/10.1146/annurev.micro.50.1.753SilverSPhungLT. Bacterial heavy metal resistance: new Surprises. Annu Rev Microbiol. 1996Oct;50(1):753789. https://doi.org/10.1146/annurev.micro.50.1.75310.1146/annurev.micro.50.1.753Search in Google Scholar

Summers AO. Generally overlooked fundamentals of bacterial genetics and ecology. Clin. Infect. 2002 Jun 1;34(Suppl 3):S85–S92. https://doi.org/10.1086/340245SummersAO. Generally overlooked fundamentals of bacterial genetics and ecology. Clin. Infect. 2002Jun1;34(Suppl 3):S85S92. https://doi.org/10.1086/34024510.1086/340245Search in Google Scholar

Sütterlin S, Edquist P, Sandegren L, Adler M, Tängdén T, Drobni M, Olsen B, Melhus Å. Silver resistance genes are overrepresented among Escherichia coli isolates with CTX-M production. Appl Environ Microbiol. 2014 Nov 15;80(22):6863–6869. https://doi.org/10.1128/AEM.01803-14SütterlinSEdquistPSandegrenLAdlerMTängdénTDrobniMOlsenBMelhusÅ. Silver resistance genes are overrepresented among Escherichia coli isolates with CTX-M production. Appl Environ Microbiol. 2014Nov15;80(22):68636869. https://doi.org/10.1128/AEM.01803-1410.1128/AEM.01803-14424900325128339Search in Google Scholar

Tamura K, Nei M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol Biol Evol. 1993 May;10(3):512–526. https://doi.org/10.1093/oxfordjournals.molbev.a040023TamuraKNeiM. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol Biol Evol. 1993May;10(3):512526. https://doi.org/10.1093/oxfordjournals.molbev.a04002310.1093/oxfordjournals.molbev.a0400238336541Search in Google Scholar

Tchounwou PB, Yedjou CG, Patlolla AK, Sutton DJ. Heavy metal toxicity and the environment. In: Luch A, editor. Molecular, clinical and environmental toxicology. Basel (Switzerland): Springer; 2012. p. 133–164. https://doi.org/10.1007/978-3-7643-8340-4_6TchounwouPBYedjouCGPatlollaAKSuttonDJ. Heavy metal toxicity and the environment. In: LuchA, editor. Molecular, clinical and environmental toxicology. Basel (Switzerland): Springer; 2012. p. 133164. https://doi.org/10.1007/978-3-7643-8340-4_610.1007/978-3-7643-8340-4_6414427022945569Search in Google Scholar

Vicente A, Avilés M, Codina JC, Borrego JJ, Romero P. Resistance to antibiotics and heavy metals of Pseudontonas aeruginosa isolated from natural waters. J Appl Bacteriol. 1990 Jun;68(6):625–632. https://doi.org/10.1111/j.1365-2672.1990.tb05228.xVicenteAAvilésMCodinaJCBorregoJJRomeroP. Resistance to antibiotics and heavy metals of Pseudontonas aeruginosa isolated from natural waters. J Appl Bacteriol. 1990Jun;68(6):625632. https://doi.org/10.1111/j.1365-2672.1990.tb05228.x10.1111/j.1365-2672.1990.tb05228.x2118131Search in Google Scholar

Zhang S, Wang Y, Song H, Lu J, Yuan Z, Guo J. Copper nanoparticles and copper ions promote horizontal transfer of plasmid-mediated multi-antibiotic resistance genes across bacterial genera. Environ Int. 2019 Aug;129:478–487. https://doi.org/10.1016/j.envint.2019.05.054ZhangSWangYSongHLuJYuanZGuoJ. Copper nanoparticles and copper ions promote horizontal transfer of plasmid-mediated multi-antibiotic resistance genes across bacterial genera. Environ Int. 2019Aug;129:478487. https://doi.org/10.1016/j.envint.2019.05.05410.1016/j.envint.2019.05.05431158594Search in Google Scholar

Recommended articles from Trend MD

Plan your remote conference with Sciendo