Proteomic studies have explored the stem expansion process of
In our previous studies on the
Male
Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis were performed to clarify the biological functions of DEGs. The Goseq R package (Young et al., 2010) was used for GO enrichment analysis of DEGs, and KOBAS software (Bu et al., 2021) was used to assess pathways enriched in DEGs. The plant TF database (PlantTFDB,
Twenty DEGs were selected and real-time fluorescence quantitative PCR (qPCR) was used to confirm the reliability of the transcriptome data. Total RNA from male
WGCNA was used to cluster differential genes with common expression and high correlations into the same module, then select target modules; KEGG enrichment analysis was then performed on the target module to identify important metabolic pathways, the complete metabolic pathway was drawn and relevant DEGs were screened. DEGs were detected by qPCR using the primers shown in Table 1. Combined with the transcriptome results, candidate genes of male
Real-time fluorescence qPCR primers for candidate genes
Gene name | Forward primer (5′ – 3′) | Reverse primer (5′ – 3′) |
---|---|---|
AGTGGTGACTCTGGAATTGG | G-CCCATGAGTGTGTTGTGATCT | |
CATGGAAGGAAGGCAGATAC | CAAAGCCACCCTCACCTATT | |
GAGTCAAGACAGGGAGTAAAGG | CCTTCCACACAATAGCCATAAAG | |
GCAGAGAATCACAGTTGAGGAG | GCTTCATCTGGTCCTCGTTTAG | |
TAT-CCACCTCACGCCCAGT | TA-TCCTTGACGACGCCTCC | |
TCCTACTCAGACTTCTCGTTCC | CTGCTGCTGCTGACATCTATAC | |
CACGACAACGAGAACTCC | GATCTCAATCTCCGACCT | |
GGATTCCAAGAGATGGAGGAAAG | TCGATGTCGCTCATGGTTTG | |
GC-TGACCACCAAATCTTCGACTAC | GCTCATGGAGTTCTCGTTGT | |
C-TATGTGCACGGCAGATGTT | C-GCTTGTAATGACGCTCCTATC | |
AACGTGTTGTGGCGCTTA | TTGCAGCCCGTTCAAACT | |
GACAAGACGGTGGTATGGTATG | GGGATCTCGAAGAGAAAGAACC | |
G-ACAAGGCGGGCTCTTATTT | GGTACTAGGAGTTGCTGTGAAG | |
CAAGTAGGTCAGGGTGGATTTG | CTTGTTTGGTGCCAGGAGT | |
GCAGAGAATCACAGTTGAGGAG | GCTTCATCTGGTCCTCGTTTAG | |
TGGGTATCAATGGCGGAAG | CCTTCTTCTTCACCGGACAC | |
ACGGAAGGCAACGTTTGA | GGTCGAAAGCTGGGTAGTATG | |
C-TAACCGGCCACGTGTATTT | AGAGCAGAGGCATTCCAAGT |
qPCR, quantitative PCR.
Microsoft Excel 2016 software (Microsoft Corp., Redmond, WA, USA) was used for basic processing of test data, IBM SPSS statistics 25 software (Jackson and Ukwe, 2022) was used for analysis of variance (
DEGs in treatment and control groups were statistically analysed using DESeq2 software with screening criteria of fold change ≥2 and
A total of 1,226 DEGs were identified in the three comparison groups (CK-3 hr vs. TR-3 hr, CK-12 hr vs. TR-12 hr and CK-24 hr vs. TR-24 hr), and hierarchical cluster analysis was carried out according to the fragments per kilobase of exon per million mapped fragments (FPKM) values of DEGs. The results showed that the three biological repeats of treatment and control groups were clustered together at each timepoint, indicating tight correlations and reliable results that could be used for subsequent analysis (Figure 1).
The top 20 GO nodes with the most significant enrichment
Pathway analysis of compared DEGs revealed that the number of pathways enriched in the CK-3 hr vs. TR-3 hr comparison was the most (100), followed by CK-24 hr vs. TR-24 hr (65) and CK-12 hr vs. TR-12 hr (13). At 3 hr after inoculation, the most enriched DEGs were related to the plant–pathogen interaction pathway, indicating that these genes play a key role in the interaction between male
In order to predict the TFs mediating the responses of male
Twenty DEGs were selected, specific primers were designed and the reliability of transcriptome data was assessed by qPCR. The results showed that expression of 19 differential genes was consistent with the transcriptome data, with
WGCNA was used to construct a gene coexpression network, and seven characteristic modules were identified by correlation analysis between gene expression modules and
DEGs in the ‘plant–pathogen interaction’ and ‘MAPK signalling pathway-plant’ pathways were analysed at 3 hr after inoculation. A total of 17 DEGs were identified, consisting of 2 LRR receptor kinase
In order to further explore the expression of genes related to ‘plant–pathogen interaction’ and ‘MAPK signalling pathway-plant’ pathways, total RNA from male
Pathogens invading plants are attacked by the plant immune system. Firstly, signal networks such as the MAPK cascade can help plants identify foreign invaders and quickly trigger immune responses to prevent infection (Cheng et al., 2012). Secondly, plant hormones also play an important role in helping plants respond to adverse environments (Verma et al., 2016). For example, gibberellin (GA), abscisic acid (ABA), indole acetic acid (IAA) and cytokinin hormones are related to plant defence signal pathways, and play an important role in regulating plant defence response to pathogen infection (Bari and Jones, 2009). In this study, DEGs were mainly associated with the metabolic pathways of auxins, cytokinins, gibberellins, abscisic acid, brassinosteroids and jasmonic acid. Among them, brassinosteroid pathways accounted for the most (12) DEGs (9 upregulated, 3 downregulated), followed by auxin (2 upregulated, 5 downregulated) and jasmonic acid pathway (6 upregulated, 1 downregulated), but further investigation is needed to ascertain whether these genes participate in the response process. Additionally, phenylpropane derivatives participate in the biosynthesis of lignin or flavonoids, and can also enhance the resistance of plants to pathogens (Dong and Lin, 2021). In the present study, 1,226 DEGs were identified at different timepoints after inoculation of
TFs are important participants in plant responses to biological stress that can enhance the ability of plants to resist insect attack and pathogen infection (Amorim et al., 2017). As regulatory proteins, TFs play an important role in transcription reprogramming (Bordenave et al., 2013). Members of WRKY, NAC, MYB and other TF families are involved in the regulation of plant response to biological stress (Feller et al., 2011; Amorim et al., 2017; Li et al., 2017). Cui et al. (2019) found that the
With the rapid development of sequencing technology, the cost of genome detection has been greatly reduced, and transcriptome sequencing has become a popular choice to study differential gene expression. However, RNA-seq still faces many challenges in terms of data processing and analysis. Studies have shown that only 85% of results are typically consistent with qPCR results. Through analysis of all inconsistent genes, it was found that they were usually small in length, with fewer exons, and relatively scarce in the transcriptome (Everaert et al., 2017). In the present study, when the transcriptome was verified by qPCR, 19 of 20 DEGs were consistent with the transcriptome sequencing results. Subsequently, screening criteria can be optimised, and highly expressed DEGs can be selected for further analysis.
During evolution, plants have evolved various defence mechanisms to resist infection by pathogens. These include the nonspecific pattern-triggered immunity (PTI) mechanism induced by pathogen-related molecular patterns (PAMPs) mediated by pattern recognition receptors (PRRs), and effector-triggered immunity (ETI), a specific defence mechanism induced by effector proteins secreted by pathogens (Liu, 2018; Zhang et al., 2018). Studies have shown that the MAPK pathway transmits extracellular signals to downstream response factors through receptors on the cell membrane via MAPKKK, MAPKK and MAPK, and plays an important role in PTI and ETI defence responses (Wang et al., 2019). In plant nonspecific defences, FLS2 combines with the receptor kinase BAK1 to activate immune responses (Chinchilla et al., 2007). In the present study, at 3 hr after inoculation with