Chrysanthemum (
Chrysanthemum virus B was found to be the most frequent chrysanthemum-infecting virus, followed by CMV, TAV and members of
Chrysanthemum virus B is globally distributed according to where chrysanthemums are grown and has been reported in many countries of Asia, including India (Verma et al., 2004), Japan (Yamamoto et al., 2001), Taiwan (Lin et al., 2005) and China (Zhao et al., 2015). In Thailand, chrysanthemums have been grown for decades, but the detection of CVB has not been reported.
Molecular techniques based on polymerase chain reaction (PCR) are commonly used to diagnose plant virus diseases. Loop-mediated isothermal amplification (LAMP) has been widely applied for the detection of many plant viruses and can detect both DNA and RNA viruses (reverse transcription (RT)-LAMP) (Panno et al., 2020). The LAMP technique was first developed by Notomi et al. (2000), and it has high sensitivity and specificity based on the use of four specific primers that recognise six distinct regions on the target DNA. LAMP reactions require four to six primers (loop-F and loop-B are additional primers) that are specific to six to eight positions on the target gene, leading to higher sensitivity and specificity compared to reverse transcription polymerase chain reaction (RT-PCR), which requires only two primers (Panno et al., 2020). The LAMP reaction is based on DNA strand displacement activity mediated by
In this study, we aimed to detect and identify CVB infecting chrysanthemum in Thailand and describe the molecular, biological and structural characteristics of the Thai CVB isolate. To improve the effectiveness of virus detection, colourimetric RT-LAMP was developed.
Surveys were conducted at chrysanthemum plantations in Chiang Mai and Chiang Rai Provinces, northern Thailand, during 2019–2021. Chrysanthemum leaves showing virus-like symptoms, such as mild mottling, vein clearing and yellowing, in addition to samples without symptoms, were collected for detection of CVB by RT-PCR. The percentage of disease incidence (PDI) was calculated as described by Ali et al. (2013).
Total RNA was extracted from 0.1 g chrysanthemum leaf using TRIzol® Reagent (Invitrogen, Waltham, USA) according to the manufacturer's instructions. The RT reaction was performed by using ReverTra Ace™ qPCR RT Master Mix with gDNA Remover (Toyobo, Osaka, Japan) following the manufacturer's protocol for synthesising cDNA. The cDNA was kept at −20 °C until use in PCR and colourimetric LAMP detection.
The primer set specific to partial triple block gene-3 (
The PCR products of partial
To study the pathogenicity of CVB in indicator plants, the virus was isolated from infected chrysanthemum leaves that were determined to be CVB positive based on RT-PCR. The leaves were ground in 0.1 M phosphate buffer (pH 7.0) and then mechanically inoculated with
Four LAMP primers, consisting of forward inner primer (FIP), backward inner primer (BIP), forward primer (F3) and backward primer (B3), were designed based on the partial
Colourimetric LAMP reaction was performed by using WarmStart® Colourimetric LAMP 2× Master Mix with uracil DNA glycosylase (UDG) (New England Biolabs, Ipswich, USA). A 25.0 μL aliquot of LAMP component was added to the 200 μL PCR tube containing 12.5 μL WarmStart® Colourimetric LAMP 2× Master Mix with UDG, 2.5 μL LAMP Primer Mix (10×), 1.0 μL of recombinant plasmid DNA and 9.0 μL of nuclease-free H2O. LAMP was performed at different incubation temperatures of 60 °C, 63 °C, 65 °C and 68 °C for 60 min to determine the optimal incubation temperature in terms of sensitivity. Subsequently, the incubation time was determined at the selected temperature for 30 min, 45 min and 60 min. The LAMP products were analysed using 1.5% AGE in 1× TBE buffer, and the gel was stained with RedSafe™ Nucleic Acid Staining Solution (iNiTron). Moreover, the results are colourimetric, whereby a change in the colour of the LAMP reaction after incubation from pink to yellow is considered a positive result, whereas a reaction that remains pink indicates a negative result.
Primers used for detection of CVB by RT-PCR and colourimetric RT-LAMP techniques in this study.
Type of detection | Primer name | Sequence (5′-3′) | Target gene(s) | Ta*** (°C) | Reference |
---|---|---|---|---|---|
PCR | CVB-F1 |
AGTCACAATGCCTCCCAAAC |
54 | Guan et al. (2017) | |
PCR and sequencing | CVB-up |
TAGGTTGTGGAGTGGTTACA |
56 | Lin et al. (2005) | |
LAMP | FIP* |
CCTGCTCACGCTCTCGTTCCCAGCTCGAACAGCGGAAG |
63–68 | This study |
FIP: forward inner primer containing F1c + F2.
Ta: annealing temperature.
BIP, backward inner primer containing B1c + B2; B3, backward primer;
To evaluate the limit of detection (LOD) of the LAMP reaction, 10-fold serial dilution (100–10−10) was performed to dilute the CVB plasmid of partial
To address possible cross-reactivity, the positive cDNA of other viruses and viroids (TMV, turnip mosaic virus (TuMV), melon yellow spot virus (MYSV), CChMVd and CSVd) and cDNA from a healthy chrysanthemum were used. The LAMP reaction was performed under optimal conditions, and LAMP products were visualised along with the colourimetric observation as previously described. To evaluate the performance of the colourimetric RT-LAMP technique in detecting CVB, 10 new chrysanthemum leaves were collected and subjected to CVB detection.
Four chrysanthemum plantation areas were surveyed, and 110 samples of chrysanthemum leaf were collected. From a total of 110 samples, 95 samples displayed virus-like symptoms including mosaic, mottling, leaf malformation, chlorotic spots and necrotic spots (NSs), and 15 samples were symptomless. PCR products of 621 bp specific to the partial
Symptoms observed on chrysanthemum leaves collected from Chiang Mai Province of Thailand that were positive to CVB detection by using RT-PCR. (A) Chlorosis and yellowing symptoms (the red arrow). (B) The mild mottling symptom. CVB, chrysanthemum virus B; RT-PCR; reverse transcription polymerase chain reaction.
The complete
The pairwise identity matrix of nucleotide sequences of CVB and other members of the genus
Colour-coded pairwise identity matrix generated from 35 virus sequences consisting of CVB isolates, other members of the genus
The phylogenetic tree based on the ML method showed that CVB-BW-54 (accession №. OL804013) and CVB-HL4-70 (accession №. OL804014) clustered into the CVB clade and closely clustered with isolates from India, but far from isolates from China and Russia and some from India (Figure 3). CVB isolates are clearly separated from other members of the genus
The phylogenetic relationship of CVB-BW-54 and CVB-HL4-70 (the red box) and members of the genus
CVB-BW-54 was used for the bioassay. At 10 days post-inoculation (dpi), inoculation with
Symptoms induced by CVB on indicator plants after mechanical inoculation.
Indicator plants | Symptoms | |
---|---|---|
Inoculated leaf | Upper leaf | |
CS | – | |
CS | – | |
– | Y | |
– | M, Ma | |
NS | – | |
– | M, Ma | |
NS | – | |
– | M, Ma | |
– | – |
CS: chlorotic spot; CVB, chrysanthemum virus B; M, mosaic; Ma, malformation; NS, necrotic spot; Y, yellowing; –, no symptom.
Four LAMP primers were designed: FIP, BIP, F3 and B3 (Table 1). The positions where LAMP primers anneal to the CVB genome, and the corresponding sequence, are illustrated in Figure 4. FIP and BIP primers were prepared at 16 μM stock concentration and F3 and B3 primers at 8 μM stock concentration.
Diagram of LAMP primers’ attachment on the partial ORF4 (
The results show detection of a ladder pattern of LAMP products with incubation at 60 min for all tested temperatures (60 °C, 63 °C, 65 °C and 68 °C) (Figure 5A). Then, incubation times of 30 min, 45 min and 60 min for incubation at 65 °C were tested according to the manufacturer's recommendation. The results revealed that LAMP products were detected with incubation at 65 °C for 45 min and 60 min (Figure 5B). Based on the highest intensity of LAMP products, the optimal condition for CVB detection was incubation at 65 °C for 45 min. In all cases, the positive LAMP results consistently showed a colour change from pink to yellow, whereas the negative results consistently remained pink (Figures 5A and 5B).
Optimisation of RT-LAMP for detection of CVB. (A) Optimisation of temperature at 60 °C, 63 °C, 65 °C and 68 °C for 60 min. (B) Optimising time of incubation at 65 °C for 30 min, 45 min and 60 min. CVB, chrysanthemum virus B; M, DNA ladder; NC, negative control (nuclease-free water).
The LOD of LAMP for CVB plasmid was up to 100 fg (10−9) (Figure 6A), which is 106 times higher compared to RT-PCR. The LOD of RT-PCR was up to 10−3 of diluted plasmid (1 ng) (Figure 6B). Colourimetric observation showed corresponding results with gel electrophoresis, whereby the colour of LAMP reactions of undiluted plasmid and plasmid diluted from 10−1 to 10−9 changed from pink to yellow, while the negative sample and plasmid diluted at 10−10 remained pink (Figure 6A).
Sensitivity test of LAMP in the detection of CVB compared with RT-PCR detection. (A) LAMP-AGE (top) with the LOD at 10−9 diluted plasmid and colourimetric LAMP (bottom). (B) PCR with LOD at 10−3 diluted plasmid. AGE, agarose gel electrophoresis; CVB, chrysanthemum virus B; LAMP, loop-mediated isothermal amplification; LOD, limits of detection; M, DNA ladder; NC, negative control (nuclease-free water); PCR, polymerase chain reaction; RT-PCR, reverse transcription polymerase chain reaction.
To assess cross-reactivity, LAMP reaction using the LAMP primers designed in this study was performed at the optimal condition (incubation at 65 °C for 45 min) with other viruses and viroids. The results show that the LAMP product was observed only in the CVB lane and not in other lanes corresponding to non-CVB viruses and viroids, with corresponding colourimetric results (Figure 7A).
Specificity assay and evaluation of colourimetric RT-LAMP for detection of CVB. (A) The LAMP product was observed only in the lane of CVB. (B) Evaluation of colourimetric RT-LAMP for detection of CVB from random chrysanthemum samples. (C) RT-PCR detection. CChMVd, chrysanthemum chlorotic mottle viroid; CSVd, chrysanthemum stunt viroid; CVB, chrysanthemum virus B; LAMP, loop-mediated isothermal amplification; Lanes 1–10, chrysanthemum samples; M, DNA ladder; MYSV, melon yellow spot virus; NC, negative control (nuclease-free water); PC, positive control; RT-PCR, reverse transcription polymerase chain reaction; TMV, tobacco mosaic virus; TuMV, turnip mosaic virus.
Ten chrysanthemum samples were newly collected and used to test the efficacy of colourimetric RT-LAMP in CVB detection. The results showed that four samples were positive for CVB based on the observation of LAMP products analysed by gel electrophoresis and the colour change from pink to yellow of RT-LAMP reactions (Figure 7B, lanes 2, 4, 6 and 10). The negative results of RT-LAMP reactions remained pink (Figure 7B, lanes 1, 3, 5 and 7–9). RT-PCR was used to detect CVB compared to colourimetric RT-LAMP and showed the same results, detecting PCR products with 621 bp of CVB from four LAMP-positive samples (Figure 7C, lanes 2, 4, 6 and 10). According to the colourimetric evaluation of RT-LAMP results of CVB detection, in which 4 of 10 newly collected chrysanthemum samples were positive, the PDI of CVB in chrysanthemum of Thailand was recalculated as 5% (6/120 samples).
Chrysanthemum plants are susceptible to CVB infection; however, some cultivars can be tolerant to virus infection and remain symptom-free and unharmed, which does not have any effects on production and is referred to as latent infection (Yamamoto et al., 2001). On the other hand, susceptible chrysanthemum cultivars exhibit yellowing, mottling and vein banding symptoms (Hollings, 1957; Verma et al., 2003; Singh et al., 2012). In Taiwan, most CVB-infected chrysanthemum are symptom-free, with only a small percentage of plants exhibiting mild mottling symptoms on their leaves (Lin et al., 2005). Lin et al. (2005) reported that the symptoms are less likely to occur at lower temperatures; therefore, disease development in chrysanthemum depends on the cultivar and environmental conditions.
In India, CVB is generally found in coinfections with CMV and shows the characteristic symptoms (Verma et al., 2004). In this study, we assessed whether there was coinfection by attempting to detect CMV, TAV, CSNV, INSV, TSWV and ZYMV in chrysanthemum samples by RT-PCR, but the results were negative in all cases (data not shown). CChMVd and CSVd were detected, but not in samples that were positive for CVB (data not shown). Therefore, we assumed that the CVB infections in the chrysanthemum samples in this study represent a single infection.
As mechanical inoculation of CVB in chrysanthemum is difficult (Hollings, 1957), we concluded that
RT-LAMP for detecting CVB was previously developed and reported by Liu et al. (2014); in that report, detection condition was optimal with incubation at 63 °C for 60 min, whereby LAMP demonstrated 103 times higher sensitivity than conventional PCR. In this study, CVB was successfully detected by colourimetric RT-LAMP with incubation at 65 °C for 45 min, whereby the sensitivity was 106 times higher compared to RT-PCR, and positive results were easily observed by the change of colour from pink to yellow. The duration of LAMP detection did not exceed 75 min, with gel electrophoresis included (30 min), being overall shorter than RT-PCR (2.0–2.5 h). Gel electrophoresis is not necessary for colourimetric LAMP because the colour change in LAMP reactions can be visualised by the naked eye. Therefore, colourimetric RT-LAMP is complete within 45 min. This indicates that the RT-LAMP method for detecting CVB developed in this study is more effective than the previous protocol based on its shorter procedure time, higher sensitivity and simple visualisation of results.
In conclusion, we report and describe CVB infection in chrysanthemum from Thailand, along with the molecular and biological characterisation of CVB isolate BW54 detected in this study. Colourimetric RT-LAMP was developed by designing new sets of LAMP primers, which demonstrated successful detection of CVB from chrysanthemum. Moreover, the time for colourimetric RT-LAMP detection is shorter than RT-PCR, reducing processing time by approximately 2 h. When using colourimetric obser vation, gel electrophoresis is not needed, which means colourimetric RT-LAMP detection can be achieved within 45 min. A comparison of nucleotide sequences of the