Open Access

Analysis of the genetic diversity and population structures of black locust (Robinia pseudoacacia L.) stands in Poland based on simple sequence repeat markers

Iwona Szyp-Borowska
Iwona Szyp-Borowska
, 
Anna Zawadzka
Anna Zawadzka
, 
Tomasz Wojda
Tomasz Wojda
 and 
Marcin Klisz
Marcin Klisz
   | Dec 12, 2023
Folia Forestalia Polonica's Cover Image
About this article
Previous Article
Next Article
Cite
Article Category: Original Article
Published Online: Dec 12, 2023
Page range: 187 - 198
Received: Jun 28, 2023
Accepted: Oct 26, 2023
DOI: https://doi.org/10.2478/ffp-2023-0019
Keywords
© 2023 Iwona Szyp-Borowska et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Figure 1.

Allelic patterns for R. pseudoacacia populations. Na – number of alleles per locus, Ne – number of effective alleles, I – Shannon's information index
Allelic patterns for R. pseudoacacia populations. Na – number of alleles per locus, Ne – number of effective alleles, I – Shannon's information index

Figure 2.

Relationships among the populations of Robinia pseudoacacia. A principal coordinate analysis (PCoA) based on pairwise genetic distance estimates for all populations. Percentages of total variance explained by coordinates 1 and 2 accounting for 68.99 and 14.23%, respectively
Relationships among the populations of Robinia pseudoacacia. A principal coordinate analysis (PCoA) based on pairwise genetic distance estimates for all populations. Percentages of total variance explained by coordinates 1 and 2 accounting for 68.99 and 14.23%, respectively

The genetic diversity indexes for each locus

Locus Na Ho uHe FIS
Rops15 20 0.968 0.716 −0.378
Rops16 19 0.677 0.555 −0.252
Rops18 6 0.051 0.063 0.121

Genetic diversity of populations of R. pseudoacacia revealed by microsatellite loci

Forest stands Ho He H F
Cybinka 0.445 0.291 0.295 −0.310
Krosno232 0.600 0.469 0.473 0.076
Krosno90 0.620 0.353 0.358 −0.757
Miechów 0.67 0.373 0.380 −0.820
Pińczów 0.552 0.632 0.663 0.068
Strzelce 0.472 0.446 0.453 −0.060
Wołów 0.623 0.456 0.472 −0.306
Oborniki Śl. 0.44 0.49 0.501 0.145
Buckow 0.67 0.40 0.406 −0.663
Total 0.56 0.433 0.445 −0.260

Analysis of molecular variance (AMOVA) of genetic diversity of R. pseudoacacia populations

Source df SS MS Est. var. %
Among pops 8 88.163 11.020 0.335 37
Within pops 275 157.488 0.573 0.573 63
Total 283 245.651 0.908 100

Forest stands where plant material was collected for genetic analyses. The origin of the plant material is indicated in brackets

No. Forestry division Area (ha) Tree age (years) Geographical coordinates
1 Cybinka (PL) 1.05 72

N 52 7 23.7

E 14 56 43.5
2 Krosno 232 (PL) 3.18 92

N 52 8 24.1

E 14 55 14.3
3 Krosno 90 (PL) 1.14 39

N 52 5 40.2

E 14 58 13.7
4 Mieszkowice (PL) 1.31 50

N 52 51 31.5

E 14 11 40.7
5 Pińczów (PL) 3.19 38

N 50 15 53.0

E 20 42 7.2
6 Strzelce (PL) 1.36 40

N 50 29 37.7

E 18 2 54.2
7 Wołów (PL) 2.86 46 N 51 25 12.5
8 Oborniki Śląskie (HU) 1.09 15

N 51 22 39.5

E 16 53 23.7
9 Buckow (DE) 1.10 58 N 52 33 32.8

Nuclear microsatellite loci used in the analysis of genetic diversity of R. pseudoacacia

Locus Repeat Primer sequence (5′–3′) Ta. (°C) Size range (bp) No. of alleles GenBank NCBI accession no.
Rops15 (CT)20 GCCCATTTTCAAGAATCCATATATTGG 54 112–254 43 AB120731
TCATCCTTGTTTTGGACAATC
Rops16 (CT)13 AACCCTAAAAGCCTCGTTATC 56 195–223 15 AB120732
TGGCATTTTTTGGAAGACACC
Rops18 (AC)8 AGATAAGATCAAGTGCAAGAGTGTAAG 54 135–219 13 AB120733
TAATCCTCGAGGGAACAATAC

The mean FIS and FIT values for population of R. pseudoacacia

F-statistics Value P
FST 0.412 0.001
FIS −0.170 0.649
FIT 0.246 0.001
Nm 0.771
eISSN:
2199-5907
ISSN:
0071-6677
Language:
English
Publication timeframe:
4 times per year
Journal Subjects:
Life Sciences, Plant Science, Medicine, Veterinary Medicine
Journal RSS Feed