Open Access

Differentially Expressed Circulating Long-Noncoding RNAS in Premature Infants with Respiratory Distress Syndrome

ZD Bao
ZD Bao
, 
J Wan
J Wan
, 
W Zhu
W Zhu
, 
JX Shen
JX Shen
, 
Y Yang
Y Yang
 and 
XY Zhou
XY Zhou
   | Jul 31, 2023
Balkan Journal of Medical Genetics's Cover Image
About this article
Previous Article
Next Article
Cite
Article Category: Original Article
Published Online: Jul 31, 2023
Page range: 11 - 20
DOI: https://doi.org/10.2478/bjmg-2023-0011
Keywords
© 2023 ZD Bao et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Figure 1.

The recruitment procedures of the patients.
The recruitment procedures of the patients.

Figure 2.

Hierarchical clustering of lncRNA expression among the three groups. (A) 108 upregulated lncRNAs, (B) 27 downregulated lncRNAs. Red indicates significantly increased expression. Green indicates significantly reduced expression, and black indicates no difference in expression levels.
Hierarchical clustering of lncRNA expression among the three groups. (A) 108 upregulated lncRNAs, (B) 27 downregulated lncRNAs. Red indicates significantly increased expression. Green indicates significantly reduced expression, and black indicates no difference in expression levels.

Figure 3.

GO and KEGG analysis of lncRNA function-related mRNAs. (A) GO terms associated with mRNAs related to upregulated lncRNAs on biological process. (B) GO terms associated with mRNAs related to downregulated lncRNAs on biological process. (C) Bubble Diagram of the KEGG pathways of mRNAs associated with upregulated lncRNAs. (D) Bubble Diagram of the KEGG pathways of mRNAs associated with downregulated lncRNAs.
GO and KEGG analysis of lncRNA function-related mRNAs. (A) GO terms associated with mRNAs related to upregulated lncRNAs on biological process. (B) GO terms associated with mRNAs related to downregulated lncRNAs on biological process. (C) Bubble Diagram of the KEGG pathways of mRNAs associated with upregulated lncRNAs. (D) Bubble Diagram of the KEGG pathways of mRNAs associated with downregulated lncRNAs.

Figure 4.

qRT-PCR of the differentially expressed lncRNAs. The expression level of differentially expressed four lncRNAs were further determined using qRT-PCR. Group1 was infants without RDS, Group2 was infants with mild RDS, and Group3 was infants with severe RDS. (A) relative expression of ENST00000417781.5, (B) relative expression of ENST00000440408.5, (C) relative expression of ENST00000504497.1, (D) relative expression of ENST00000470527.1
qRT-PCR of the differentially expressed lncRNAs. The expression level of differentially expressed four lncRNAs were further determined using qRT-PCR. Group1 was infants without RDS, Group2 was infants with mild RDS, and Group3 was infants with severe RDS. (A) relative expression of ENST00000417781.5, (B) relative expression of ENST00000440408.5, (C) relative expression of ENST00000504497.1, (D) relative expression of ENST00000470527.1

Figure 5.

Pathway regulatory network of four validated lncRNAs. Red triangles indicate the four selected lncRNAs. Blue circles indicate mRNAs down-regulated by lncRNAs, while red circles indicate mRNAs up-regulated by lncRNAs, respectively. Arrows indicat1e signaling pathways associated with protein-coding genes co-expressed with the four selected lncRNAs.
Pathway regulatory network of four validated lncRNAs. Red triangles indicate the four selected lncRNAs. Blue circles indicate mRNAs down-regulated by lncRNAs, while red circles indicate mRNAs up-regulated by lncRNAs, respectively. Arrows indicat1e signaling pathways associated with protein-coding genes co-expressed with the four selected lncRNAs.

The differentially expressed lncRNAs (Fold change> 2)

LncRNA Gene Trend CHR Strand
ENST00000417781.5 CSE1L-AS1 Up chr20 −
ENST00000418924.6 RIN3 Up chr14 +
ENST00000440408.5 TTTY15 Up chrY +
ENST00000467315.5 PFKL Up chr21 +
ENST00000470527.1 CACHD1 Up chr1 +
ENST00000481985.5 RPL3 Up chr22 −
ENST00000488606.5 MRPS15 Up chr1 −
ENST00000497617.1 TSFM Up chr12 +
ENST00000504497.1 DMXL1 Up chr5 +
ENST00000530931.1 CD82 Up chr11 +
ENST00000460278.5 ANKRD28 Down chr3 −
ENST00000544168.5 AKT1 Down chr14 −
ENST00000611549.4 RAP1GAP Down chr1 −
ENST00000491117.5 GNA12 Down chr7 −
ENST00000610076.1 KCNT2 Down chr1 −
ENST00000601034.2 INTS6-AS1 Down chr13 +
ENST00000570265.5 C15orf41 Down chr15 +
ENST00000592944.1 ITGA2B Down chr17 −
ENST00000494731.5 ZDHHC20 Down chr13 −
ENST00000628791.1 AC093495.1 Down chr3 +

The primers sequence for qPCR

Gene name Primer (5′-3′)
ENST00000470527.1 Forward TGGAATTCGATGGGAACTTT
Reverse GTCTCGTCCTGGATTGAAGG
ENST00000504497.1 Forward TCGATTCTCCTGTCAGTGAAC
Reverse AATGTTTCCAGAGCACCACT
ENST00000417781.5 Forward GTTGATCGATCCAAGGTCGT
Reverse GCCTGGAATCCCAGCATTT
ENST00000440408.5 Forward TGCTTGGACAACAGACATGA
Reverse GAAGCAATGTAATCCCAGCA
GAPDH Forward AACTTTGGCATTGTGGAAGG
Reverse GGATGCAGGGATGATGTTCT

The differentially expressed mRNAs (Fold change> 2)

mRNA lncRNA Trend CHR Strand
AC027796.3 ENSG00000262304.2 Up chr17 −
AQP7 ENSG00000165269.12 Up chr9 −
ARNT2 ENSG00000172379.20 Up chr15 +
DGCR6 ENSG00000183628.12 Up chr22 +
GRID2IP ENSG00000215045.8 Up chr7 −
MICU3 ENSG00000155970.11 Up chr8 +
MROH7-TTC4 ENSG00000271723.5 Up chr1 +
RHOXF1 ENSG00000101883.4 Up chrX −
ZNF683 ENSG00000176083.17 Up chr1 −
AC046185.1 ENSG00000125695.12 Down chr17 −
AC137834.1 ENSG00000258830.1 Down chr12 −
AL136295.1 ENSG00000254692.1 Down chr14 −
BLOC1S5-TXNDC5 ENSG00000259040.5 Down chr6 −
CTSV ENSG00000136943.10 Down chr9 −
CYP3A5 ENSG00000106258.13 Down chr7 −
GABRE ENSG00000102287.18 Down chrX −
GSTM5 ENSG00000134201.10 Down chr1 +
KCNT2 ENSG00000162687.16 Down chr1 −
MRAP2 ENSG00000135324.5 Down chr6 +
MYZAP ENSG00000263155.5 Down chr15 +
PKDCC ENSG00000162878.12 Down chr2 +
PPP1R14C ENSG00000198729.4 Down chr6 +
SH3D19 ENSG00000109686.17 Down chr4 −
SLC2A14 ENSG00000173262.11 Down chr12 −

Clinical characteristics of the three groups

Group G1 (N=5) G2 (N=5) G3 (N=5) P valve
Gestational age (week) 32.54±2.35 32.14±3.47 31.11±1.15 0.66
Birth weight (g) 1654.00±540.81 1622.00±503.16 1473.00±274.94 0.81
Apgar score at 5 min 9.20±0.84 8.40±1.14 8.40±1.14 0.41
Male (%) 40.00 40.00 20.00 0.78
Cesarean section (%) 40.00 40.00 60.00 0.80
Twins (%) 20.00 0 20.00 0.62
Gestational diabetes (%) 60.00 40.00 40.00 0.80
Without glucocorticoid usage before delivery (%) 40.00 20.00 40.00 0.78
eISSN:
2199-5761
Language:
English
Publication timeframe:
2 times per year
Journal Subjects:
Medicine, Basic Medical Science, other
Journal RSS Feed