Association of rs35006907 Polymorphism with Risk of Dilated Cardiomyopathy in Han Chinese Population

In this study, a total of 529 idiopathic DCM patients and 600 healthy controls were recruited between March 2014 and June 2017 from the Cardiology Division of Panzhihua central hospital in Sichuan. The diagnostic criteria of DCM refers to the modified version of standardized diagnostic criteria for DCM [19]. Patients with a family history of DCM, cardiac valve disease, coronary heart disease, hypertension, tachyarrhythmia, congenital heart disease, pericardial disease, acute viral myocarditis, heavy alcohol intake, skeletal myopathies, systemic diseases of a putative autoimmune origin, diabetes, and nutrition disorders were excluded from our study. Participants of healthy controls are free of cardiac disease, cardiac dysfunction, and a family history of DCM. Echocardiography was conducted for all participants to assess their heart function. 32 human heart samples used in this study were obtained between April 2015 and July 2017 from patients who received heart transplants at Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology. Our study was in accordance with the principles of the Helsinki Declaration and approved by the Review Board of Tongji College of Medicine and Panzhihua central hospital. All patients have signed the informed consent. Detailed about clinical characteristics of patients are listed in Supplemental Table 1

Genomic DNA extraction from peripheral leucocytes were finished using a DNA isolation kit in accordance with the protocol (TIANGEN, Beijing, China) and quantified by a NanoDrop 2000 Spectrophotometer (NanoDrop Technologies, Wilmington, DE). The final concentration of the samples ranged from 10 to 30 ng/mL. Probe and primer for rs35006907 genotyping were purchased from ThermoFisher (Assay ID: C____449430_10). The variant rs35006907 was genotyped using a TaqMan assay on the TaqMan 7900HT Sequence Detection System (Applied Biosystems, Foster City, CA) with the following condition: 10 min at 95 °C (enzyme activation) followed by 45 cycles at 95 °C for 15 s and 60 °C for 1 min (annealing/extension).

To investigate the effect of rs35006907 on transcription activity of MTSS1, we constructed the reporter plasmids using PGL3-promoter. Related primer and restriction enzyme cutting sites are shown below: Forward primer with KpnI 5′ GGTACCGCACAATTTGCCAATGAGTTCAAAG 3′, reverse primer with MluI 5′ ACGCGTGGGAGAGGTTTACCAGCAGAAG 3′. AC16 and HEK293T were used for the luciferase reporter assay. Details about cell culture and transient transfection procedures have been described previously [20]. Cells were harvested 36 to 48 hours after transfection using the Passive Lysis Buffer (SIRIUS, Pforzheim, Germany). The data of luciferase expression levels were adjusted with reference to Renilla luciferase activity and relative to the average values of wild-type variant. Six independent experiments were conducted for each reporter to avoid potential errors.

A total of 20ug of protein extracts for each sample were denatured in sample buffer (SDS polyacrylamide) containing β-mercaptoethanol and electrophoretically resolved by 10% SDS-polyacrylamide gels, followed by transferring to polyvinylidene difluoride membranes. Non-specific binding sites were blocked with 5% non-fat milk for 2 h at room temperature. Subsequently, the membranes were incubated with primary antibodies (anti-MTSS1 and GAPDH antibodies were purchased from ABclonal, article number: A11697 and AC002) overnight at 4 °C, followed by incubation with a peroxidase-conjugated secondary antibody. Bands were visualized by enhanced chemiluminescence reagents (Pierce Chemical, Rockford, IL) and quantified by densitometry.

To determine the effect of rs35006907 on MTSS1 expression, we collected 126 samples of peripheral blood lymphocytes from participants undergoing coronary angiography. Total RNA was extracted from the peripheral blood lymphocytes using the RNeasy Mini Kit (Qiagen) and DNase-treated with DNA-free reagent (Promega), and then converted to cDNA in 20ul of reverse transcriptase reaction with random hexamers (Roche Diagnostics) and Moloney murine leukemia virus reverse transcriptase (Promega). The mRNA levels of MTSS1 and GAPDH were measured using realtime fluorescence quantitative PCR with each sample in triplicate. Relevant primer sequences and detailed characteristics of individuals are shown on Supplemental Table 2 and 3, respectively. Expression of MTSS1 relative to GAPDH was compared among individuals with different genotype.

SPSS version 13.0 (SPSS, Inc, Chicago, Illinois) for Windows (Microsoft Corp, Redmond, WA) and Prism (GraphPad) were used for the statistical analyses in our study. Normality was assessed using Shapiro–Wilk’s test with SPSS version 13.0. Polymorphism was tested for Hardy-Weinberg equilibrium (HWE) among the DCM patients and controls using χ² test with SPSS version 13.0. We conducted binary logistic regression to test the association of rs35006907 with DCM in different genetic models (additive, dominant and recessive models) using SPSS version 13.0. The odds ratio (OR) and its 95% confidence intervals (95% CIs) were calculated to evaluate the effect of any differences between alleles or genotypes with SPSS version 13.0. The Mann–Whitney U test was used for comparison between two continuous data with Prism (GraphPad), while categorical data were compared using Pearson’s chi-square test. Data are expressed as mean ± SEM of n experiments. P<0.05 was considered to be significant.

As shown in Table 1, a total of 529 DCM and 600 healthy controls were matched by age with mean age of 56.6±10.5 and 55.8±9.6, respectively. There were no statistical differences between DCM and the control group in age (p=0.15), gender (p=0.5), SBP (p= 0.054), DBP (p= 0.09) or IVSD (p=0.3) between DCM and control groups. Compared with controls, the LVEDD and LVPWD were significantly higher in DCM group, while the LVEF was clearly lower.

The genotype distribution was in HWE in both groups (χ² =2.7, p = 0.1 in DCM group; χ² =1.8, p = 0.18 in controls). As shown in Table 2, the frequency of A allele among DCM group was remarkably lower compared with controls (38% vs 44%). The results showed that rs35006907-A allele is significantly associated with reduced risk of DCM in additive (p= 0.004; OR=0.78; 95% CI=0.66–0.93) and recessive model (p=0.0005; OR=0.56; 95%CI=0.41–0.78) when compared with rs35006907-C allele.

We attempted to explore the relationship between rs35006907 and clinical characteristics in DCM patients. As shown in Figure 1, patients carrying AA genotype displayed reduced LVEDD and increased LVEF when compared with CC (p=0.0001 for LVEDD and p<0.0001 for LVEF) and AC (p=0.003 for LVEDD and p=0.03 for LVEF) genotype. While no differences were observed in IVSD and LVPWD between different genotypes of rs35006907.

Firstly, we attempted to compare the MTSS1 expression among 3 genotypes of rs35006907 using human heart samples. The results indicated that MTSS1 mRNA level of CC genotype showed significantly higher than AC genotype (p=0.0028) and AA genotype (p=0.0034) (shown in Figure 2A). The difference between AC and AA genotypes had no statistical significance but showed a trend, probably owing to the limited samples. Furthermore, western blot results also demonstrated that CC genotype displayed increased protein expression when compared with the AC and AA genotypes (shown in Figure 2B).

Subsequently, we investigated the effect of rs35006907 on MTSS1 expression in lymphocytes including 126 samples (33 CC genotype, 71 AC and 22 AA genotype). As shown in Figure 2C, MTSS1 mRNA of participants with the CC genotype were significantly higher than AC genotype (p<0.0001) and AA genotype (p<0.0001). Similarly, the difference between the AC and AA genotypes was also statistically significant (p=0.005).

Figure 1.

Finally, we transfected AC16 and 293T cells with reporter plasmids and found that the reporter gene expression of rs35006907-C allele was significantly increased compared with the rs35006907-A allele (shown in Figure 2D).