Breast cancer represents the second most deadly malignancy in women, and long noncoding RNAs (lncRNAs) have crucial functions in its development.
To investigate effects of the promoter of
lncRNAs potentially regulating the transcriptional activity of the E-cadherin (E-cad, an epithelial cell marker) gene promoter were screened using a dual-luciferase reporter assay.
Keywords
- breast neoplasms
- epithelial-mesenchymal transition
- long noncoding RNA PANDAR
- human
- cell proliferation
Breast cancer is a major malignancy affecting women worldwide [1]. Annually, approximately 1.4 million new breast cancer cases are recorded, with 410,000 women eventually dying, accounting for 14.1% of cancer-related deaths in female patients. Treatment for breast cancer has been reported to fail in 25%–40% of breast cancer patients within 5 years due to distant metastasis [2], which is the leading cause of death in affected individuals. Therefore, exploring the mechanisms that increase malignancy and poor treatment response is required to discover new biomarkers and treatment approaches.
Epithelial-mesenchymal transition (EMT) is a process by which epithelial cells undergo transformation to acquire mesenchymal features, generating malignant cells harboring stem cell-like properties, also known as cancer stem cells (CSCs), including migration and invasion, reduced apoptosis and senescence, and drug resistance [3], thus facilitating the metastatic cascade. A recent study found that the mesenchymal state is responsible for a lower degree of tumor cell differentiation, which is related to poor prognosis in patients [3]. EMT occurs throughout different stages of embryonic development and is induced via a panel of specific transcription factors. A previous review discussed the relationship between EMT-inducing transcription factors and cadherin modulation—these involving E-cadherin (E-cad) and N-cadherin (N-cad) through embryonic development and cancer progression [4]. A recent review indicated that a hallmark of EMT is the upregulation of N-cad followed by the downregulation of E-cad [5].
Long noncoding RNAs (lncRNAs) constitute a group of small RNAs with >200 bp and without an open reading frame, which inhibit the expression of downstream genes predominantly by affecting the activity of the upstream promoter region [6]. lncRNAs can contribute critically to the pathogenesis and development of breast cancer [7]. For example, the lncRNA
Here, we assessed the effects of
Human breast invasive ductal carcinoma Michigan cancer foundation 7 (MCF-7) cells were obtained from the American Type Culture Collection (catalog No. HTB-22), HEK-293T cells (catalog No. GNHu17) were obtained from the China Center for Type Culture Collection of the National Collection of Authenticated Cell Cultures Cell Bank affiliated with the Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences, and these were maintained in Dulbecco's modified Eagle's medium (DMEM; Gibco) containing 10% fetal bovine serum (Gibco), penicillin (100 U/mL), and streptomycin (100 mg/mL). Cells were incubated in culture medium under a humidified atmosphere of 5% CO2 in air at 37 °C. Cell identity had been confirmed by short tandem repeat DNA profiling, and PCR had been used to confirm the absence of any mycoplasma contamination.
The genes of lncRNAs, including
The human and mouse E-cad gene promoters (Nos. 42081 and 61798) reporter plasmids were purchased from Addgene. lncRNA expression vectors, reporter plasmid containing mouse E-cad promoter, and internal control plasmid pRL-TK were cotransfected into HEK-293T cells. The pRL-TK vector served as a reference for normalizing transfection efficiency. At 48 h after transfection, dual-luciferase assays were performed by using a dual-luciferase reporter assay kit (Promega), according to the manufacturer's instructions. The ratio of firefly-to-
LentiX-293 cells were seeded into a 10 cm dish at 2.5 × 106 cells/dish. On the next day, a mixture of 5 μg pLVX-PANDAR or pLVX-Puro, 3.75 μg psPAX2 (catalog No. 12260; Addgene), and 1.25 μg pMD2.G (catalog No. 12259; Addgene) were diluted into 1 mL opti-MEM medium (Invitrogen); then, 30 μL PEI solution (1 mg/mL, catalog No. 23966; Polyscience) was added and mixed thoroughly. The mixture was incubated at room temperature for 25 min to prepare the transfection complexes. Then, the mixture was added dropwise into the abovementioned LentiX-293 cells. At 48 h after transfection, the supernatants were collected and centrifuged at 40,000 ×
Total RNA was extracted from cells using TRIzol reagent (Invitrogen) according to the manufacturer's instructions. The cDNA was synthesized through reverse-transcription reaction with Rever-Tra-Ace-α-Transcriptase (Toyobo) and subsequently amplified by PCR using SYBR Premix Ex Taq II (Tli RNaseH Plus) (TaKaRa Bio). The primer sequences used in quantitative real-time polymerase chain reaction (qRT-PCR) are listed as follows:
The harvested cells were pelleted and resuspended in sodium dodecyl sulfate (SDS) lysis buffer (50 mM pH 6.8 Tris-HCl, 1% SDS, 10% glycerol, and 20 mM dithiothreitol) and incubated on ice. The lysates were centrifuged at 8,000 ×
A cell counting kit-8 (CCK-8) was used to assess cell viability. Briefly, MCF-7 stable cell line overexpressing
Data are shown as means ± SD calculated by WPS Office 2019. The empirical data obtained from all experiments were fitted to histograms using GraphPad Prism 7 software. The experiments were performed in triplicate and repeated (more than once). A Student
E-cad, a biomarker of epithelial cells, is downregulated in the EMT process. Therefore, lncRNAs altering E-cad expression are involved in carcinogenesis. We constructed a series of noncoding RNA expression vectors and verified their overexpression effects in HEK-293T cells (
Figure 1
Screening of lncRNAs regulating the activity of the E-cad gene promoter. (

To explore which regulation mechanism is evolutionarily conservative, the mouse E-cad promoter reporter vector and a series of lncRNAs or circular RNAs were cotransfected into HEK-293T cells, respectively. This was done to assess whether the abilities of
Because
Figure 2

MCF-7 cell expressing
Figure 3
MCF-7 cell proliferation is significantly increased after

Several previously constructed recombinant lncRNA plasmids were screened by dual-luciferase reporter assay. In the present research,
Primer sequences.
HOTAIR | CAAGCTTCGAATTACGAATTCGACTCGCCTGTGCTCTGGAGCTTG | TTATCTAGAGTCGCGGGATCGGAAAATGCATCCAGATATTAATAT |
TCONS00068220 | CAAGCTTCGAATTACGAATTCCCGACTTTCACTTATCAGACCTTG | TTATCTAGAGTCGCGGGATCGGGTGAGCAGTTTTTATTAACCTGT |
PANDAR | CAAGCTTCGAATTACGAATTCTTTCAGGAATGCCGCAGATGTACA | TTATCTAGAGTCGCGGGATCGCAGTGGCTCACGCCTGTAATCTCA |
Western blotting was performed to determine the expression profile of EMT-related proteins, including E-cad, and N-cad. The results show that
By contrast,
The lncRNA
Figure 1

Figure 2

Figure 3

Primer sequences.
HOTAIR | CAAGCTTCGAATTACGAATTCGACTCGCCTGTGCTCTGGAGCTTG | TTATCTAGAGTCGCGGGATCGGAAAATGCATCCAGATATTAATAT |
TCONS00068220 | CAAGCTTCGAATTACGAATTCCCGACTTTCACTTATCAGACCTTG | TTATCTAGAGTCGCGGGATCGGGTGAGCAGTTTTTATTAACCTGT |
PANDAR | CAAGCTTCGAATTACGAATTCTTTCAGGAATGCCGCAGATGTACA | TTATCTAGAGTCGCGGGATCGCAGTGGCTCACGCCTGTAATCTCA |
Optimal diagnosis and management of non-alcoholic fatty liver disease PIWI-interacting RNA (piRNA): a narrative review of its biogenesis, function, and emerging role in lung cancer Multivariable analysis of clinical and laboratory data manifestations predicting severity and mortality risk in patients with Coronavirus disease 2019 in the mountainous west of Iran: a retrospective single-center study Diagnostic accuracy of complete blood cell count and neutrophil-to-lymphocyte, lymphocyte-to-monocyte, and platelet-to-lymphocyte ratios for neonatal infection Association between serum uric acid level and non-alcoholic fatty liver disease in Koreans Neurological manifestations and etiological risk factors in patients hospitalized with COVID-19 in Turkey