1. bookVolume 67 (2018): Issue 4 (December 2018)
Journal Details
License
Format
Journal
eISSN
2544-4646
First Published
04 Mar 1952
Publication timeframe
4 times per year
Languages
English
access type Open Access

Drug Susceptibility of Non-tuberculous Strains of Mycobacterium Isolated from Birds from Poland

Published Online: 10 Dec 2018
Volume & Issue: Volume 67 (2018) - Issue 4 (December 2018)
Page range: 487 - 492
Received: 09 Jun 2018
Accepted: 17 Sep 2018
Journal Details
License
Format
Journal
eISSN
2544-4646
First Published
04 Mar 1952
Publication timeframe
4 times per year
Languages
English
Abstract

Mycobacterioses are a constant problem in backyard poultry, as well as pet birds. To date, no evidence of direct transmission of atypical bacilli between humans has been demonstrated, but it cannot be ruled out that sick animals can be a source of infection for people in their environment. The aim of the study was to identify mycobacteria isolated from birds with diagnosed mycobacteriosis and to determine the susceptibility of mycobacterial isolates from these animals to antituberculous drugs most commonly used in the treatment of mycobacterial infections in humans. For drug susceptibility tests, drugs such as isoniazid, rifampicin, streptomycin, ethambutol, ofloxacin, capreomycin, cycloserine and ethionamide were used. A high degree of drug resistance was demonstrated, particularly in Mycobacterium avium. Isolates of Mycobacterium xenopi showed a relatively good susceptibility to the drugs tested. The drug resistance of Mycobacterium genavense has not been determined, but this mycobacterium was identified in ten cases, which is the second most frequent occurrence in the cases studied.

Keywords

Introduction

The genus Mycobacterium consists of more than 180 species with validly published names (Parte 2014). Most of them are saprophytic species widely distributed in the environment, some of which are pathogenic to humans and animals, including birds (Tan et al. 2016). Tuberculosis caused by the Mycobacterium tuberculosis complex has been found in birds that had contact with humans. Although in most of these cases the source of infection was human, domestic birds not only can be infection vectors, but also can show symptoms typical of the open form of tuberculosis, which results in active mycobacteria release to the environment, sometimes for long time periods (Washko et al. 1998; Montali et al. 2001; Steinmetz et al. 2006; Peters et al. 2007; Ledwoń et al. 2008; Lanteri et al. 2011). In birds, mycobacteriosis caused by non-tuberculous mycobacteria (NTM) is definitely a more common problem than tuberculosis. Clinical manifestations of mycobacteriosis in birds include emaciation, depression and diarrhea along with a marked atrophy of the breast muscle. Tubercular nodules can be seen in the liver, spleen, intestine and bone marrow. Granulomatous lesions without calcification are a prominent feature. The disease is rare in the well-organized poultry sector due to improved farm practices, but occurs in backyard poultry, zoos and aviaries (Portaels et al. 1996; Shitaye et al. 2008; Dhama et al. 2011; Pfeiffer et al. 2017). Mycobacterioses also pose a constantly and increasingly growing threat to human health, especially in people with weakened immunity (Schitaye et al. 2008; Slany et al. 2016; Titmarsh 2017). The mycobacteria most frequently isolated from birds with mycobacteriosis are Mycobacterium avium and Mycobacterium genavense. These bacteria are also a frequent cause of disease in people infected with Human Immunodeficiency Virus (HIV) (Ristola et al. 1999) or those receiving immunosuppressive treatment after transplantation or other systemic diseases (Tortoli 2006; Lastours de et al. 2008; Tan et al. 2016). A study conducted by Garcia-Marcos et al. (2017) showed a correlation between the occurrence of mycobacteriosis in children and their exposure to chickens. But NTM can also cause disease in adult immunocompetent patients (Piersimoni and Scarparo 2006; Santos et al. 2014). Because backyard poultry, pet birds and synanthropic animals live in the immediate vicinity of humans, it is important to study strains with potential pathogenicity for humans, as well as to assess the risk posed by their antibiotic resistance.

Experimental
Materials and Methods

The 46 samples tested (Table I) were collected over ten years from 37 dead and nine live birds originating mainly from Warsaw (Poland) and nearby areas. In the necropsied birds, except for one case, when the cause of death was a mechanical injury, advanced mycobacteriosis was diagnosed as the main cause of death. From the necropsied animals, liver samples were collected for microbiological and molecular examination. Samples from living birds were taken from areas affected by lesions associated with the disease. In three peafowl with symptoms of dyspnoea, tracheal swabs were collected. In two falcons, samples from abscesses localized within the subcutaneous tissue of the legs were collected. Faecal samples were taken from canaries and finches. These birds came from breeding sites in which cases of canary death due to mycobacteriosis had been reported earlier. Microscopic examinations of individually collected faeces from these aviaries allowed identification of carriers. Moreover, the presence of leukocytosis with neutrophilia and monocytosis confirmed active infection in those birds.

Microorganisms present in the materials taken from birds with recognized mycobacteriosis.

Avian species with diagnosed mycobacteriosisNo. of birds/AFB + samplesNo. of cultured samplesMycobacterium species (No. of isolates)
Ornamental chickens (Gallus gallus)8/88Mycobacterium avium (8)
Indian peafowl (Pavo cristatus)5/35Mycobacterium avium (5)
Pheasants (Phasianus spp.)5/54 + 1*Mycobacterium avium (5)
Turkey (Melleagris gallopavo)1/11Mycobacterium avium (1)
Red-fronted parakeet (Cyanoramphus novaezelandiae)3/32 1Mycobacterium avium (2) Mycobacterium xenopi (1)*
Barred parakeet (Bolborhynchus lineola)1/11*Mycobacterium genavense (1)
Fischer’s lovebird (Agapornis fischeri)1/11Mycobacterium xenopi (1)
Budgerigar (Melopsittacus undulatus)1/11*Mycobacterium genavense (1)
Cockatiel (Nymphicus hollandicus)1/10Mycobacterium genavense (1)
Atlantic canary (Serinus canaria)5/52* 1**Mycobacterium genavense (5) Mycobacterium xenopi (1)
Goldfinch (Carduelis carduelis)1/10Mycobacterim spp. (1)
Bengalese finch (Lonchura striata domestica)2/21* 1Mycobacterium genavense (1) Mycobacterium spp. (1)
Common buzzard (Buteo buteo)2/21 1*Mycobacterium avium (1) Mycobacterium genavense (1)
Peregrine falcon (Falco peregrinus)2/22Mycobacterium avium (2)
Rock pigeon (Columba livia)3/3***3Mycobacterium avium (3)
Common wood pigeon (Columba palumbus)2/22*Mycobacterium avium (2)
Rook (Corvus frugilegus)2/22Mycobacterium avium (2)
Total: 4645/4340(46)**

Lack of growth on media for drug resistance testing

In one necropsied canary coinfection with M. genavense and M. xenopi were diagnosed

In one case of mycobacteriosis in a pigeon flock, M. avium was isolated from 19 individuals, but as all isolates were the same strain; therefore, they are considered as one case on the list

Identification of mycobacteria. All samples were stained with TB Ziehl-Neelsen KIT (QCA, Spain). Decontamination of clinical and dissected material was carried out using Sputofluol® (Merck, Germany), in accordance with the manufacturer’s instruction. An initial culture of samples was carried out for up to 10 weeks at 37°C on the Löwenstein-Jansen PACT medium (Becton Dickinson, USA) and then up to six weeks on Bactec MGIT 960 (Becton Dickinson, USA). Positive cultures were investigated using the BD MGIT TBc Identification Test (TBc ID, Becton Dickinson, Sparks, MD), which is an immunochromatographic assay for a rapid discrimination between the M. tuberculosis complex and NTM. The TBc ID test is based on the detection of the antigen MPT64, one of the predominant proteins secreted by the M. tuberculosis complex strains during culture (Martin et al. 2011). The NTM samples were then tested using the GenoType Mycobacterium CM VER 2.0 test, a molecular genetic assay for the identification of clinically relevant mycobacterial species from mycobacterium contaminated material (Hain Lifescience GmbH, Germany).

Samples that did not grow on the Löwenstein-Jansen medium (Becton Dickinson, USA) were cultured onto the Middlebrook 7H9 (Becton Dickinson, USA) liquid medium supplemented with 2 mg/l Mycobactin J (Allied Monitor, Fayette, USA) (Coyle et al. 1992) for 20 weeks. Identification of samples from which no culture was obtained or were grown on the media with Mycobactin J was performed using SYBR® Green real-time PCR specific for M. genavense. DNA isolation from the liver tissue or bacterial cultures was performed using the GeneMATRIX Tissue & Bacterial DNA Purification Kit (Eurx®, Poland), while DNA isolation from faeces was made using the GeneMATRIX Stool DNA Purification Kit (Eurx®, Poland). The chosen forward primer MG 25-s(GAATCCGCTGCTGCTCTG) was located at nucleotides 378 to 395 of a M. genavense hypothetical 21 kDa protein gene (Chevrier, et al. 1999), while the backward primer MG25-as (TCAATGTAGTCCTGTCCGAAC) corresponded to nucleotides 313 to 291. Real-time PCR amplification was carried out in a total volume of 25 µl using SG qPCR Master Mix (Eurx®, Poland) according to the methodology described by the authors earlier (Ledwoń et al. 2009).

Drug susceptibility testing. Drug susceptibility tests were conducted using 34 mycobacterial isolates, including 31 M. avium subsp. avium and three Mycobacterium xenopi. Determination of susceptibility to drugs was performed by using the proportion method on the Löwenstein-Jensen and Middlebrook 7H9 media (Canetti et al. 1969; Zwolska et al. 1999; Augustynowicz-Kopeć et al. 2003). The susceptibility to isoniazid, rifampicin, streptomycin, ethambutol, ofloxacin, capreomycin, cycloserine and ethionamide was tested on the Löwenstein-Jansen medium. The susceptibility to clofazimine, rifabutin and sulfamethoxazole + trimethoprim was tested on the Middlebrook 7H9 medium. The concentrations of the antibiotics tested were as follows: streptomycin – 4.0, 8.0 µg/ml; isoniazid – 0.2, 0.4 µg/ml; rifampicin – 40.0, 80.0 µg/ml; ethambutol 2.0, 4.0 µg/ml; ofloxacin – 2.5, 5.0 µg/ml; capreomycin – 40.0, 80.0 µg/ml; cycloserine – 40.0, 80.0 µg/ml; ethionamide – 40.0, 80.0 µg/ml; clofazimine – 1.0, 2.0, 4.0 µg/ml; rifabutin – 0.5, 1.0, 2.0 µg/ml, and sulfamethoxazole + trimethoprim – 8.0, 16.0, and 32.0 µg/ml. Resistance was defined by the growth of ≥ 1% of a bacillary inoculum on the drug-containing medium compared to a drug-free control.

Results

Mycobacteriosis was found in 46 birds belonging to 17 bird species (Table I). Gallinaceous birds were diagnosed with only M. avium infections, while pet birds were also diagnosed with M. genavense and M. xenopi infections. One dead canary was found to be infected with both M. genavense and M. xenopi. In wild birds, M. avium predominated, although M. genavense was found in one buzzard. Positive Ziehl-Neelsen staining (AFB +) was observed in 43 cases analysed. The growth of bacterial colonies on the Löwenstein-Jensen and Bactec MGIT 960 media was noticed for 34 samples collected. 31 isolates of M. avium and three isolates of M. xenopi were cultured. Drug susceptibility was tested for 28 M. avium and three M. xenopi strains (Table II and Table III). M. avium strains from common pheasant (Phasianus colchicus) and wood pigeons (Columba palumbus) did not demonstrate any growth on the media used for the assessment of drug resistance. Ten samples were identified as M. genavense, five of which were cultured on the Middlebrook 7H9 medium with Mycobactin J. Two samples were identified as Mycobacterium spp. These mycobacteria were also incapable of growing on the medium for susceptibility testing.

Drug resistance of 28 strains of M. avium isolated from birds.

Drug*SMINHRFPEMBCPMOFLOXCSETHSXTCFMRIF
Susceptible800020025382710
Moderately susceptible000000001000
Moderately resistant00000000608
Resistant4282828528204110
No data**1600030125000

SM – streptomycin, RFP – rifampicin, INH – isoniazid, EMB – ethambutol, CPM – capreomycin, OFLOX – ofloxacin, CS – cycloserine, ETH – ethionamide, SXT – sulfamethoxazole + trimethoprim, CFM – clofazimine, RIF – rifabutin

Number of strains which did not demonstrate any growth on the media used for the assessment of drug resistance

Drug susceptibility of three M. xenopi strains isolated from pet birds.

Drug*sSMINHRFPEMBCPMOFLOXCSETHSXTCFMRIF
Susceptible10223323333
Resistant03110000000
No data**20000010000

SM – streptomycin, RFP – rifampicin, INH – isoniazid, EMB – ethambutol, CPM – capreomycin, OFLOX – ofloxacin, CS – cycloserine, ETH – ethionamide, SXT – sulfamethoxazole + trimethoprim, CFM – clofazimine, RIF – rifabutin

Number of strains which did not demonstrate any growth on the media used for the assessment of drug susceptibility

Discussion

M. avium and M. genavense have been the main causes of mycobacterioses described to date in birds (Tell et al. 2001; Shivaprasad and Palmieri 2012; Pfeffer et al. 2017). Our study confirmed the results published by other authors. Mycobacterioses caused by M. xenopi are very rarely diagnosed in birds (St-Jean et al. 2018). In our investigations, even though only three isolates were obtained, it should not be underestimated. M. xenopi has recently been isolated from water (Slozarek et al. 1993) which is also a source of infection for humans and animals. Birds that were diagnosed with this bacterial infection, however, came from various breeders, so it could not be concluded that they infected themselves with the same water intake.

M. genavense is very difficult to be cultured on the media, and its diagnostics are mainly based on molecular methods (Hoop et al. 1993; Portaels et al. 1996; Ledwoń et al. 2009; Palmieri et al. 2013). Therefore, the drug susceptibility tests used in this study may not be useful for testing of these mycobacteria. Strains of M. avium (Table II) demonstrated 100% resistance to isoniazid, rifampicin and ethambutol, while strains tested on ethionamide showed a good susceptibility to that antibiotic. These results differ from those described in a study by Parvandar et al. (2016) in which all M. avium strains isolated from pigeons for drug susceptibility tests were shown to be resistant to streptomycin, kanamycin, ethionamide and thiophene carboxylic acid hydrazide. Moreover, single isolates were susceptible to isoniazid, rifampicin and ethambutol (Parvandar et al. 2016). In the cases described by Stepień-Pyśniak et al. (2016), M. avium strains isolated from birds demonstrated resistance to isoniazid, rifampicin, ethambutol, ethionamide, capreomycin and ofloxacin, and were susceptible to streptomycin and cycloserine. M. xenopi isolated from birds (Table III) presented resistance similar to that of isolates originating from humans (van Ingen et al. 2010). These isolates were resistant to isoniazid, slightly less resistant to rifampicin and ethambutol, and fully susceptible to other antibiotics. All three species of mycobacteria identified from the cases of mycobacteriosis in birds are able to cause mycobacteriosis in humans, particularly in immunocompromised hosts (Coyle et al. 1992; Ristola et al. 1999; Bluth et al. 2009; Shah et al. 2016; Adzic-Vukicevic et al. 2018). Therefore, mycobacterioses in birds living in a direct proximity to humans should be taken seriously, since they can constitute a potential reservoir of infection with mycobacteria resistant to multiple antimycobacterial drugs.

Drug susceptibility of three M. xenopi strains isolated from pet birds.

Drug*sSMINHRFPEMBCPMOFLOXCSETHSXTCFMRIF
Susceptible10223323333
Resistant03110000000
No data**20000010000

Drug resistance of 28 strains of M. avium isolated from birds.

Drug*SMINHRFPEMBCPMOFLOXCSETHSXTCFMRIF
Susceptible800020025382710
Moderately susceptible000000001000
Moderately resistant00000000608
Resistant4282828528204110
No data**1600030125000

Microorganisms present in the materials taken from birds with recognized mycobacteriosis.

Avian species with diagnosed mycobacteriosisNo. of birds/AFB + samplesNo. of cultured samplesMycobacterium species (No. of isolates)
Ornamental chickens (Gallus gallus)8/88Mycobacterium avium (8)
Indian peafowl (Pavo cristatus)5/35Mycobacterium avium (5)
Pheasants (Phasianus spp.)5/54 + 1*Mycobacterium avium (5)
Turkey (Melleagris gallopavo)1/11Mycobacterium avium (1)
Red-fronted parakeet (Cyanoramphus novaezelandiae)3/32 1Mycobacterium avium (2) Mycobacterium xenopi (1)*
Barred parakeet (Bolborhynchus lineola)1/11*Mycobacterium genavense (1)
Fischer’s lovebird (Agapornis fischeri)1/11Mycobacterium xenopi (1)
Budgerigar (Melopsittacus undulatus)1/11*Mycobacterium genavense (1)
Cockatiel (Nymphicus hollandicus)1/10Mycobacterium genavense (1)
Atlantic canary (Serinus canaria)5/52* 1**Mycobacterium genavense (5) Mycobacterium xenopi (1)
Goldfinch (Carduelis carduelis)1/10Mycobacterim spp. (1)
Bengalese finch (Lonchura striata domestica)2/21* 1Mycobacterium genavense (1) Mycobacterium spp. (1)
Common buzzard (Buteo buteo)2/21 1*Mycobacterium avium (1) Mycobacterium genavense (1)
Peregrine falcon (Falco peregrinus)2/22Mycobacterium avium (2)
Rock pigeon (Columba livia)3/3***3Mycobacterium avium (3)
Common wood pigeon (Columba palumbus)2/22*Mycobacterium avium (2)
Rook (Corvus frugilegus)2/22Mycobacterium avium (2)
Total: 4645/4340(46)**

Adzic-Vukicevic T, Barac A., Blanka-Protic A., Laban-Lazovic M., Lukovic B., Skodric-Trifunovic V. and Rubino S. 2018. Clinical features of infection caused by non-tuberculous mycobacteria: 7 years’ experience. Infection. 46:357–363.Adzic-VukicevicTBaracA.Blanka-ProticA.Laban-LazovicM.LukovicB.Skodric-TrifunovicV. and RubinoS2018Clinical features of infection caused by non-tuberculous mycobacteria: 7 years’ experienceInfection4635736310.1007/s15010-018-1128-229476412Search in Google Scholar

Augustynowicz-Kopeć E, Zwolska Z, Jaworski A, Kostrzewa E, Klatt M. 2003. Drug-resistant tuberculosis in Poland in 2000: second national survey and comparison with the 1997 survey. Int J Tuberc Lung Dis. 7(7):645–651.Augustynowicz-KopećEZwolskaZJaworskiAKostrzewaEKlattM2003Drug-resistant tuberculosis in Poland in 2000: second national survey and comparison with the 1997 surveyInt J Tuberc Lung Dis7(7):645651Search in Google Scholar

Bluth MH, Vera R, Razeq J, Kramer M, Abu-Lawi KI. 2009. Mycobacterium xenopi: evidence for increased rate of clinical isolation. Int J Biomed Sci. 5(2):96–100.BluthMHVeraRRazeqJKramerMAbu-LawiKI2009Mycobacterium xenopi: evidence for increased rate of clinical isolationInt J Biomed Sci5(2):96100Search in Google Scholar

Chevrier D, Oprisan G, Maresca A, Matsiota-Bernard P, Guesdon JL. 1999. Isolation of a specific DNA fragment and development of a PCR-based method for the detection of Mycobacterium genavense. FEMS Immunol Med Microbiol. 23(3):243–252.ChevrierDOprisanGMarescaAMatsiota-BernardPGuesdonJL1999Isolation of a specific DNA fragment and development of a PCR-based method for the detection of Mycobacterium genavenseFEMS Immunol Med Microbiol23(3):24325210.1111/j.1574-695X.1999.tb01245.x10219597Search in Google Scholar

Coyle MB, Carlson LC, Wallis CK, Leonard RB, Raisys VA, Kilburn JO, Samadpour M, Böttger EC. 1992. Laboratory aspects of “Mycobacterium genavense” a species isolated from AIDS patients. J Clin Microbiol. 30(12):3206–3212.CoyleMBCarlsonLCWallisCKLeonardRBRaisysVAKilburnJOSamadpourM, BöttgerEC1992Laboratory aspects of “Mycobacterium genavense” a species isolated from AIDS patientsJ Clin Microbiol30(12):3206321210.1128/jcm.30.12.3206-3212.19922706291280652Search in Google Scholar

de Lastours V, Guillemain R, Mainardi JL, Aubert A, Chevalier P, Lefort A, Podglajen I. 2008. Early diagnosis of disseminated Mycobacterium genavense infection. Emerg Infect Dis. 14(2):346–347.de LastoursVGuillemainRMainardiJLAubertAChevalierPLefortAPodglajenI2008Early diagnosis of disseminated Mycobacterium genavense infectionEmerg Infect Dis14(2):34634710.3201/eid1401.070901Search in Google Scholar

Dhama K, Mahendran M, Tiwari R, Dayal Singh S, Kumar D, Singh S, Sawant PM. 2011. Tuberculosis in birds: Insights into the Mycobacterium avium infections. Vet Med Int. 2011:712369.DhamaKMahendranMTiwariRDayal SinghSKumarDSinghSSawantPM2011Tuberculosis in birds: Insights into the Mycobacterium avium infectionsVet Med Int201171236910.4061/2011/712369313522021776352Search in Google Scholar

Garcia-Marcos PW, Plaza-Fornieles M, Menasalvas-Ruiz A, Ruiz-Pruneda R, Paredes-Reyes P, Miguelez SA. 2017. Risk factors of non-tuberculous mycobacterial lymphadenitis in children: a case-control study. Eur J Pediatr. 176(5):607–613.Garcia-MarcosPWPlaza-FornielesMMenasalvas-RuizARuiz-PrunedaRParedes-ReyesPMiguelezSA2017Risk factors of non-tuberculous mycobacterial lymphadenitis in children: a case-control studyEur J Pediatr176(5):60761310.1007/s00431-017-2882-328265761Search in Google Scholar

Hoop RK, Böttger EC, Ossent P, Salfinger M. 1993. Mycobacteriosis due to Mycobacterium genavense in six pet birds. J Clin Microbiol. 31(4):990–993.HoopRKBöttgerECOssentPSalfingerM1993Mycobacteriosis due to Mycobacterium genavense in six pet birdsJ Clin Microbiol31(4):99099310.1128/jcm.31.4.990-993.19932636018463407Search in Google Scholar

Lanteri G, Marino F, Reale S, Vitale F, Macrì F, Mazzullo G. 2011. Mycobacterium tuberculosis in a red-crowned parakeet (Cyanoramphus novaezelandiae). J Avian Med Surg. 25(1):40–43.LanteriGMarinoFRealeSVitaleFMacrìFMazzulloG2011Mycobacterium tuberculosis in a red-crowned parakeet (Cyanoramphus novaezelandiae)J Avian Med Surg25(1):404310.1647/2009-060.121657186Search in Google Scholar

Ledwoń A, Szeleszczuk P, Zwolska Z, Augustynowicz-Kopeć E, Sapierzyński R, Kozak M. 2008. Experimental infection of budgerigars (Melopsittacus undulatus) with five Mycobacterium species. Avian Pathol. 37(1):59–64.LedwońASzeleszczukPZwolskaZAugustynowicz-KopećESapierzyńskiRKozakM2008Experimental infection of budgerigars (Melopsittacus undulatus) with five Mycobacterium speciesAvian Pathol37(1):596410.1080/0307945070180225518202951Search in Google Scholar

Ledwoń A, Szeleszczuk P, Malicka E, Dolka I, Zwolska Z, Augustynowicz-Kopeć E, Zabost A. 2009. Mycobacteriosis caused by Mycobacterium genavense in lineolated parakeets (Bolborhynchus lineola). A case report. Bull Vet Inst Pulawy. 53:209–212.LedwońASzeleszczukPMalickaEDolkaIZwolskaZAugustynowicz-KopećEZabostA2009Mycobacteriosis caused by Mycobacterium genavense in lineolated parakeets (Bolborhynchus lineola). A case reportBull Vet Inst Pulawy53209212Search in Google Scholar

Martin A, Bombeeck D, Fissette K, de Rijk P, Hernández-Neuta I, Del Portillo P, Palomino JC. 2011. Evaluation of the BD MGIT TBc Identification Test (TBc ID), a rapid chromatographic immunoassay for the detection of Mycobacterium tuberculosis complex from liquid culture. J Microbiol Methods 84(2):255–257.MartinABombeeckDFissetteKde RijkPHernández-NeutaIDel PortilloPPalominoJC2011Evaluation of the BD MGIT TBc Identification Test (TBc ID), a rapid chromatographic immunoassay for the detection of Mycobacterium tuberculosis complex from liquid cultureJ Microbiol Methods84(2):25525710.1016/j.mimet.2010.12.00321167879Search in Google Scholar

Montali RJ, Mikota SK, Cheng LI. 2001. Mycobacterium tuberculosis in zoo and wildlife species. Rev Sci Tech. 20:291–303.MontaliRJMikotaSKChengLI2001Mycobacterium tuberculosis in zoo and wildlife speciesRev Sci Tech2029130310.20506/rst.20.1.1268Search in Google Scholar

Palmieri C, Roy P, Dhillon AS, Shivaprasad HL. 2013. Avian mycobacteriosis in psittacines: a retrospective study of 123 cases. J Comp Pathol. 148:126–138.PalmieriCRoyPDhillonASShivaprasadHL2013Avian mycobacteriosis in psittacines: a retrospective study of 123 casesJ Comp Pathol14812613810.1016/j.jcpa.2012.06.005Search in Google Scholar

Parvandar K, Mayahi M, Mosavari N, Pajoohi RA. 2015. Drug susceptibility testing of Mycobacterium avium subsp. avium isolates from naturally infected domestic pigeons to avian tuberculosis. Iran J Microbiol. 7:260–264.ParvandarKMayahiMMosavariNPajoohiRA2015Drug susceptibility testing of Mycobacterium avium subsp. avium isolates from naturally infected domestic pigeons to avian tuberculosisIran J Microbiol7260264Search in Google Scholar

Parte AC. 2014. LPSN-list of prokaryotic names with standing in nomenclature. Nucleic Acids Res. 42 D1:D613–D616.ParteAC2014LPSN-list of prokaryotic names with standing in nomenclatureNucleic Acids Res42D1D613D61610.1093/nar/gkt1111Search in Google Scholar

Peters M, Prodinger WM, Gümmer H, Hotzel H, Möbius P, Moser I. 2007. Mycobacterium tuberculosis infection in a blue-fronted amazon parrot (Amazona aestiva aestiva). Vet Microbiol. 122: 381–383.PetersMProdingerWMGümmerHHotzelHMöbiusPMoserI2007Mycobacterium tuberculosis infection in a blue-fronted amazon parrot (Amazona aestiva aestiva)Vet Microbiol12238138310.1016/j.vetmic.2007.03.030Search in Google Scholar

Piersimoni C, Scarparo C. 2008. Pulmonary infections associated with non-tuberculous mycobacteria in immunocompetent patients. Lancet Infect Dis. 8(5):323–334.PiersimoniCScarparoC2008Pulmonary infections associated with non-tuberculous mycobacteria in immunocompetent patientsLancet Infect Dis8(5):32333410.1016/S1473-3099(08)70100-2Search in Google Scholar

Pfeiffer W, Braun J, Burchell J, Witte CL, Rideout BA. 2017. Whole-genome analysis of mycobacteria from birds at the San Diego Zoo. PLoS One. 12:e0173464.PfeifferWBraunJBurchellJWitteCLRideoutBA2017Whole-genome analysis of mycobacteria from birds at the San Diego ZooPLoS One12e017346410.1371/journal.pone.0173464Search in Google Scholar

Portaels F, Realini L, Bauwens L, Hirschel B, Meyers WM, de Meurichy W. 1996. Mycobacteriosis caused by Mycobacterium genavense in birds kept in a zoo: 11-year survey. J Clin Microbiol. 34(2):319–323.PortaelsFRealiniLBauwensLHirschelBMeyersWMde MeurichyW1996Mycobacteriosis caused by Mycobacterium genavense in birds kept in a zoo: 11-year surveyJ Clin Microbiol34(2):31932310.1128/jcm.34.2.319-323.1996Search in Google Scholar

Ristola MA, von Reyn CF, Arbeit RD, Soini H, Lumio J, Ranki A, Bühler S, Waddell R, Tosteson ANA, Falkinham JO 3rd, et al. 1999. High rates of disseminated infection due to non-tuberculous mycobacteria among AIDS patients in Finland. J Infect. 39(1):61–67.RistolaMAvon ReynCFArbeitRDSoiniHLumioJRankiABühlerSWaddellRTostesonANAFalkinhamJO3rd1999High rates of disseminated infection due to non-tuberculous mycobacteria among AIDS patients in FinlandJ Infect39(1):616710.1016/S0163-4453(99)90104-4Search in Google Scholar

Santos M, Gil-Brusola A, Escandell A, Blanes M, Gobernado M. 2014. Mycobacterium genavense infections in a tertiary hospital and reviewed cases in non-HIV patients. Patholog Res Int. 2014:371370.SantosMGil-BrusolaAEscandellABlanesMGobernadoM2014Mycobacterium genavense infections in a tertiary hospital and reviewed cases in non-HIV patientsPatholog Res Int201437137010.1155/2014/371370394596724693456Search in Google Scholar

Shah NM, Davidson JA, Anderson LF, Lalor MK, Kim J, Thomas HL, Lipman M, Abubakar I. 2016. Pulmonary Mycobacterium avium-intracellulare is the main driver of the rise in nontuberculous mycobacteria incidence in England, Wales and Northern Ireland, 2007–2012. BMC Infect Dis. 16:195.ShahNMDavidsonJAAndersonLFLalorMKKimJThomasHLLipmanMAbubakarI2016Pulmonary Mycobacterium avium-intracellulare is the main driver of the rise in nontuberculous mycobacteria incidence in England, Wales and Northern Ireland, 2007–2012BMC Infect Dis1619510.1186/s12879-016-1521-3485892727154015Search in Google Scholar

Shitaye JE, Matlova L, Horvathova A, Moravkova M, Dvorska-Bartosova L, Treml F, Lamka J, Pavlik I. 2008. Mycobacterium avium subsp. avium distribution studied in a naturally infected hen flock and in the environment by culture, serotyping and IS901 RFLP methods. Vet Microbol. 127:155–164.ShitayeJEMatlovaLHorvathovaAMoravkovaMDvorska-BartosovaLTremlFLamkaJPavlikI2008Mycobacterium avium subsp. avium distribution studied in a naturally infected hen flock and in the environment by culture, serotyping and IS901 RFLP methodsVet Microbol12715516410.1016/j.vetmic.2007.07.02617870256Search in Google Scholar

Shivaprasad HL, Palmieri C. 2012. Pathology of mycobacteriosis in birds. Vet Clin North Am Exot Anim Pract. 15(1):41–55.ShivaprasadHLPalmieriC2012Pathology of mycobacteriosis in birdsVet Clin North Am Exot Anim Pract15(1):415510.1016/j.cvex.2011.11.00422244112Search in Google Scholar

Slany M., Ulmann V., Slana I. 2016. Avian mycobacteriosis: still existing threat to humans. Biomed Res Int. 2016:4387461.SlanyM.UlmannV.SlanaI2016Avian mycobacteriosis: still existing threat to humansBiomed Res Int2016438746110.1155/2016/4387461498331427556033Search in Google Scholar

Slozarek M, Kubin M, Jaresova M. 1993. Water-borne household infections due to M. xenopi. Cent Eur J Clin Microbiol. 32:1773–1778.SlozarekMKubinMJaresovaM1993Water-borne household infections due to M. xenopiCent Eur J Clin Microbiol3217731778Search in Google Scholar

Stepień-Pyśniak D, Puk K, Guz L, Wawrzyniak A, Marek A, Kosikowska U. 2016. Avian mycobacteriosis caused by Mycobacterium avium subspecies avium in four ornamental birds and in vitro drug sensitivity testing of isolates. Berl Munch Tierarztl Wochenschr. 129:65–71.Stepień-PyśniakDPukKGuzLWawrzyniakAMarekAKosikowskaU2016Avian mycobacteriosis caused by Mycobacterium avium subspecies avium in four ornamental birds and in vitro drug sensitivity testing of isolatesBerl Munch Tierarztl Wochenschr1296571Search in Google Scholar

Steinmetz HW, Rutz C, Hoop RK, Grest P, Bley CR, Hatt JM. 2006. Possible human-avian transmission of Mycobacterium tuberculosis in a green-winged macaw (Ara chloroptera). Avian Dis. 50:641–645.SteinmetzHWRutzCHoopRKGrestPBleyCRHattJM2006Possible human-avian transmission of Mycobacterium tuberculosis in a green-winged macaw (Ara chloroptera)Avian Dis5064164510.1637/7609-041906R.117274308Search in Google Scholar

St-Jean G, Gagnon CA, Soualhine H, Tremblay M, Beaulieu AA, Sylvestre D. 2018. Mycobacterium xenopi systemic infection in a domestic fiery shouldered conure bird (Pyrrhura egregia). JMM Case Rep. 5(7):e005158.St-JeanGGagnonCASoualhineHTremblayMBeaulieuAASylvestreD2018Mycobacterium xenopi systemic infection in a domestic fiery shouldered conure bird (Pyrrhura egregia)JMM Case Rep5(7):e00515810.1099/jmmcr.0.005158615954630275961Search in Google Scholar

Tan EM, Marcelin JR, Mason E, Virk A. 2016. Mycobacterium avium intracellulare complex causing olecranon bursitis and prosthetic joint infection in an immunocompromised host. J Clin Tuberc Other Mycobact. Dis. 2:1–4.TanEMMarcelinJRMasonEVirkA2016Mycobacterium avium intracellulare complex causing olecranon bursitis and prosthetic joint infection in an immunocompromised hostJ Clin Tuberc Other Mycobact. Dis21410.1016/j.jctube.2015.11.003685024731723678Search in Google Scholar

Tell LA, Woods L, Cromie RL. 2001. Mycobacteriosis in birds. Rev Sci Tech. 20:180–203.TellLAWoodsLCromieRL2001Mycobacteriosis in birdsRev Sci Tech2018020310.20506/rst.20.1.127311288511Search in Google Scholar

Titmarsh S. 2017. The growing threat of nontuberculous mycobacteria. Prescriber. 28:33–36.TitmarshS2017The growing threat of nontuberculous mycobacteriaPrescriber28333610.1002/psb.1583Search in Google Scholar

Tortoli E. 2006. The new mycobacteria: an update. FEMS Immunol Med Microbiol. 48:159–178.TortoliE2006The new mycobacteria: an updateFEMS Immunol Med Microbiol4815917810.1111/j.1574-695X.2006.00123.x17064273Search in Google Scholar

van Ingen J, van der Laan T, Dekhuijzen R, Boeree M, van Soolingen D. 2010. In vitro drug susceptibility of 2275 clinical non-tuberculous Mycobacterium isolates of 49 species in The Netherlands. Int J Antimicrob Agents. 35(2):169–173.van IngenJvan der LaanTDekhuijzenRBoereeMvan SoolingenD2010In vitro drug susceptibility of 2275 clinical non-tuberculous Mycobacterium isolates of 49 species in The NetherlandsInt J Antimicrob Agents35(2):16917310.1016/j.ijantimicag.2009.09.02320006470Search in Google Scholar

Washko RM, Hoefer H, Kiehn TE, Armstrong D, Dorsinville G, Frieden TR. 1998. Mycobacterium tuberculosis infection in a green-winged macaw (Ara chloroptera): report with public health implications. J Clin Microbiol. 36:1101–1102.WashkoRMHoeferHKiehnTEArmstrongDDorsinvilleGFriedenTR1998Mycobacterium tuberculosis infection in a green-winged macaw (Ara chloroptera): report with public health implicationsJ Clin Microbiol361101110210.1128/JCM.36.4.1101-1102.19981046979542945Search in Google Scholar

Zwolska Z, Augustynowicz-Kopeć E, Klatt M. 1999. Pierwotna i nabyta lekooporność prątków gruźlicy w Polsce. Pneumonol Alergol Pol. 67:536–545.ZwolskaZAugustynowicz-KopećEKlattM1999Pierwotna i nabyta lekooporność prątków gruźlicy w PolscePneumonol Alergol Pol67536545Search in Google Scholar

Recommended articles from Trend MD

Plan your remote conference with Sciendo