<abstract xmlns="http://www.w3.org/1999/xhtml"><p>The growing number of children with overweight and obesity constitutes a major health problem of the modern world and it has been suggested that intestinal microbiota may influence energy intake from food. The objectives of this study were to determine quantity and proportions of dominant genera of <italic>Bacteroides, Prevotella</italic> (phylum <italic>Bacteroidetes</italic>); <italic>Clostridium</italic>, <italic>Lactobacillus</italic> (phylum <italic>Firmicutes</italic>) and <italic>Bifidobacterium</italic> (phylum <italic>Actinobacteria</italic>) in the intestines and to determine the content of short-chain fatty acids (SCFAs) and branched-chain fatty acids (BCFAs) in the stool of 20 obese children and 20 children with normal body weight. Strains classified as <italic>Firmicutes</italic> (<italic>Clostridium</italic> and <italic>Lactobacillus</italic>) predominated in stool microbiota of obese children, while those of <italic>Bacteroidetes</italic> (<italic>Prevotella</italic> and <italic>Bacteroides</italic>) were in minority (<italic>p</italic> &lt; 0.001). Concentration of SCFAs in the stool of obese children was lower in comparison to the stool of normal weight children (<italic>p</italic> = 0.04). However, these differences were significant only in obese children, not in overweight children in comparison with the lean ones. Therefore, in our study obesity was associated with intestinal dysbiosis and a predominance of phylum <italic>Firmicutes</italic>. Secondly, stool of obese children contained lower amounts of SCFAs.</p></abstract>

The growing number of children with overweight and obesity constitutes a major health problem of the modern world and it has been suggested that intestinal microbiota may influence energy intake from food. The objectives of this study were to determine quantity and proportions of dominant genera of Bacteroides, Prevotella (phylum Bacteroidetes); Clostridium, Lactobacillus (phylum Firmicutes) and Bifidobacterium (phylum Actinobacteria) in the intestines and to determine the content of short-chain fatty acids (SCFAs) and branched-chain fatty acids (BCFAs) in the stool of 20 obese children and 20 children with normal body weight. Strains classified as Firmicutes (Clostridium and Lactobacillus) predominated in stool microbiota of obese children, while those of Bacteroidetes (Prevotella and Bacteroides) were in minority (p < 0.001). Concentration of SCFAs in the stool of obese children was lower in comparison to the stool of normal weight children (p = 0.04). However, these differences were significant only in obese children, not in overweight children in comparison with the lean ones. Therefore, in our study obesity was associated with intestinal dysbiosis and a predominance of phylum Firmicutes. Secondly, stool of obese children contained lower amounts of SCFAs.

Bacterial Microbiota and Fatty Acids in the Faeces of Overweight and Obese Children

Polish Journal of Microbiology

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

The growing number of children with overweight and obesity constitutes a major health problem of the modern world and it has been suggested that intestinal...

Probe	Identified microorganisms	Sequence (5’→3’)	Fluorescent label	Temp [°C]	Time [h]
Lab 158	Lactobacillus-Enterococcus	GGT ATT AGC A(T?C)CTGT TTC CA	5’Fluo	46	24
Bif 164	Bifidobacterium spp.	CAT CCG GCA TTA CCA CCC	5’Cy3	58	18
Bac 303	Bacteroides-Prevotella	CCA ATG TGG GGG ACC TT	5’Cy3	55	3
Erec 484	Clostridium coccoides	GCT TCT TAG TCA GGT ACC G	5’Cy3	57	16
Prov	Prevotella	ATCTTGAGTGAGTTCGATGTTGG	5’Fluo	57	18

Acid	Obese children			Children with normal weight
Acid	Acid concentration [mg g^–1 stool]	Average [mg g^–1 stool]	Median [mg g^–1 stool]	Acid concentration [mg g^–1 stool]	Average [mg g^–1 stool]	Median [mg g^–1 stool]	p
Lactic	0.017–4.351	1.35	1.126	0.093–4.909	2.24	1.804	0.014
Acetic	0.111–1.289	0.71	0.650	0.026–3.269	1.38	1.122	0.279
Propionic	0.085–1.232	0.67	0.594	0.050–2.128	1.08	0.985	0.354
Butyric	0.014–0.543	0.40	0.381	0.030–0.948	0.33	0.299	0.446
Formic	0.008–0.660	0.20	0.199	0.010–0.484	0.21	0.154	0.645
Valeric	0.012–0.412	0.26	0.254	0.063–0.472	0.20	0.187	0.164
Total SCFA	0.342–7.521	3.59	2.708	0.424–10.18	5.44	3.974	0.040
BCFA
Isobutyric	0.048–0.341	0.16	0.100	0.020–0.545	0.23	0.200	0.640
Isovalerian	0.017–0.528	0.20	0.120	0.001–1.180	0.20	0.121	0.913
Total BCFA	0.022–0.896	0.36	0.255	0.001–1.151	0.44	0.421	0.741

Bacterial Microbiota and Fatty Acids in the Faeces of Overweight and Obese Children

Article Category: original-paper

Published Online: Sep 04, 2018

Page range: 339 - 345

Received: Dec 28, 2017

Accepted: Jun 03, 2018

DOI: https://doi.org/10.21307/pjm-2018-041

Keywords
BCFAs, obesity, SCFAs

© 2018 Renata Barczyńska et al., published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Fig. 1.

Fig. 2.

The sequence of oligonucleotide probes and hybridization conditions used in FISH procedure for the identification of the bacteria present in children faeces.

SCFAs and BCFAs in the stool of overweight, obese and normal weight children.

Bacterial Microbiota and Fatty Acids in the Faeces of Overweight and Obese Children

Article Category: original-paper

Published Online: Sep 04, 2018

Page range: 339 - 345

Received: Dec 28, 2017

Accepted: Jun 03, 2018

DOI: https://doi.org/10.21307/pjm-2018-041

KeywordsBCFAs, obesity, SCFAs

© 2018 Renata Barczyńska et al., published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Fig. 1.

Fig. 2.

The sequence of oligonucleotide probes and hybridization conditions used in FISH procedure for the identification of the bacteria present in children faeces.

SCFAs and BCFAs in the stool of overweight, obese and normal weight children.

Keywords
BCFAs, obesity, SCFAs