Morphological and molecular characterization of Hoplolaimus pararobustus (Schuurmans Stekhoven and Teunissen, 1938) Sher 1963 with its first report on Zea mays roots in Namibia

Nematodes were extracted from roots using an adapted sugar centrifugal flotation method (Marais et al., 2017). Females and males were fixed in a heated 4% formaldehyde plus 1% propionic acid (FPG) solution, dehydrated in a glycerine solution, and mounted in glycerine on glass slides using a wax ring method (Marais et al., 2017). Measurements and drawings of the mounted specimens were done with a Nikon LABOPHOT-2 microscope equipped with a Nikon 1.25× drawing tube. All measurements were done at ×1,000 magnification. Curved structures were measured along the median line. Morphometrics were used in the descriptions with standard morphometric calculations and terms used throughout the paper (Siddiqi, 2000). Specimens were deposited in the National Collection of Nematodes (NCN), Biosystematics, Agricultural Research Council (ARC) – Plant Health and Protection (PHP), Pretoria.

DNA from previously selected living males and females was extracted using chelex-100 as described by Rashidifard et al. (2019). Polymerase chain reaction (PCR) conditions followed the protocol of Swart et al. (2020) with the following DNA markers used for DNA amplification: 28 S rDNA: D2A (5–ACAAGTACCGTGAGGGAAAGTTG–3), D3B (5–TCGGAAGGAACCAGCTACTA–3) (Subbotin et al., 2006), and 18 S rDNA: SSU F04 (GCTTGTCTCAAAGATTAAGCC), SSU R26 (CATTCTTGGCAAATGCTTTCG) (Blaxter et al., 1998). DNA of the nematode specimens was stained using GelRed, loaded on 1% agarose gel, and visualized under UV transilluminator before sequencing by Inqaba Biotec (Pty) Ltd South Africa.

The newly generated 18 S and 28 S rDNA sequences of the Namibian nematode population were compared to those available in GenBank using a BLAST search. For phylogenetic tree construction, available sequences of the subfamily Hoplolaiminae were retrieved from GenBank for 18 S and 28 S data sets. Both data sets were aligned using MUSCLE (Edgar, 2004) in Geneious Prime 2020.0.4 (https//:www.geneious.com). The jModelTest 2.1.10 program (Darriba et al., 2012) was used to identify the best nucleotide substitution model. The General Time Reversible with an invariable site and a gamma distribution (GTR + I + G) and General Time Reversible with a Gamma distribution (GTR + G) were the most suitable models for 18 S and 28 S data sets, respectively. Bayesian analysis was accomplished using MrBayes 3.2.2 (Huelsenbeck and Ronquist, 2001) in Geneious Prime 2020.0.4 (https//:www.geneious.com); the chain was run for 3×10⁶ generations for each locus. After discarding burn-in samples (25%), posterior probability (PB) of the Bayesian trees was estimated using the Markov chain Monte Carlo (MCMC) algorithm (Larget and Simon, 1999) based on the 50% majority rule. Heterodera schachtii Schmidt, 1871 and Globodera rostochiensis (Wollenweber, 1923) Skarbilovich, 1959 were, respectively, used as outgroups for the 18 S and 28 S phylogenetic trees.

Hoplolaimus pararobustus (Schuurmans Stekhoven and Teunissen, 1938) Sher, 1963 (Figure 1 and Table 1).

Figure 1:

Hoplolaimus pararobustus belongs to the group in which the lateral field is degenerate, not showing the regular compliment of four incisures and three and not six esophageal gland nuclei (Van den Berg and Quénéhervé, 2012). The current Namibian specimens are considered to be H. pararobustus because of the presence of a well set off, broadly round lip region with four annuli, lateral field represented by a single incisura, and two or three very faint incomplete incisures that can sometimes be seen in the lateral field area. Esophagus with three nuclei in three pharyngeal glands, no overlap of the rectum, and presence of males. The Namibian specimens correspond to the descriptions of Fortuner (1991), Larizza et al. (1998), and Van den Berg and Quénéhervé (2012), but for the lower range of stylet length of females (34–40 µm vs 37.5–49 µm) and males (32–42 µm vs 35–46 µm), expansion of the reported range for the position of the vulva (V = 49–67% vs V = 51–62.1%), and a shorter spicule (35–42 µm vs 40–57 µm) than that reported (Van den Berg and Buckley, 1987; Fortuner, 1991; Larizza et al., 1998). Molecular analyses indicated that H. columbus Sher, 1963 is the closest to the Namibian population of H. pararobustus. Hoplolaimus columbus was described from soybean in the USA and is currently reported from India, Pakistan, Vietnam, Egypt, and the USA (Shafiee and Osman, 1971; Fortuner, 1991). This lance nematode belongs to the group in which the lateral field is represented by one indistinct incisure and six esophageal gland nuclei, one or two sometimes indistinct (Fortuner, 1991), this is in contrast with the three nuclei observed in the Namibian specimens. The current H. pararobustus female specimens differ from H. columbus females in short body length (957–1,245 µm vs 1,260–1,800 µm), shorter stylet length (34-40 µm vs 40-48 µm; b-value (6.2–8.6 vs 9.1–12.4)). The Namibian H. pararobustus differs from H. columbus males in shorter body length (808–1,018 µm vs 1150–1,400 µm), shorter stylet length (32–38 µm vs 40.2–43.7 µm), b-value (6–7.5 vs 9.58–12.18), and o-value (8–18 vs 4.8–5.2). The constructed Bayesian tree showed that H. pararobustus also grouped in a clade with H. galeatus that is representative of the group of species with four incisures in the lateral field and three esophageal gland nuclei (Van den Berg and Quénéhervé, 2012). Hoplolaimus seinhorsti reported from Africa, Asia, and Central and South America is representative of a group with one or no incisures in the lateral field and with six pharyngeal gland nuclei.

Nucleotide BLAST search using partial 18 S sequence of H. pararobustus (MT302753, 908 bp) showed the maximum identity of 98.4% to Hoplolaimus sp. (MK292131) and 98.1% to H. galeatus (KJ934131). BLAST search based on a partial 28 S sequence of H. pararobustus (MT302643, 700 bp) revealed a maximum identity of 96.6% to Hoplolaimus sp. (KY639326) and 95.9% to a population of H. seinhorsti Luc, 1958 (KF443213). During this study, one 908-bp-long 18 S sequence (MT302753) and one 700-bp-long 28 S sequence (MT302643) were obtained and deposited into GenBank. The 18 S alignment includes 50 sequences with 777 nucleotides in length, while the 28 S alignment includes 60 sequences with 644 nucleotides in length. The constructed Bayesian tree using 18 S data set showed that H. pararobustus is in a well-supported clade with two populations of H. galeatus and one population of H. columbus with H. columbus being the closest to the Namibian population of H. pararobustus (Figure 2). The inferred Bayesian tree using the 28 S data set indicated that H. pararobustus is in a maximally supported sister relation with H. columbus, H. dubius Chaturvedi, Singh & Khera, 1979, H. indicus Sher, 1963, and H. sienhorsti of which H. columbus was the closest taxa to the Namibian population of H. pararobustus. The molecular phylogeny of the Hoplolaiminae subfamily also indicated that, based on 18 S and 28 S data sets, Rotylenchus Filipjev, 1936 and Peltamigratus Sher, 1963 were the closest genera to the genus Hoplolaimus, respectively (Figure 3).

Figure 2: