Cite

Figure 1

Protein concentrations for iCCM for every passage at different collection time points. There are no significant differences in the passage 3 protein concentration between 48 h (unfilled bars) (1023.22 ± 55.85 μg/ml) and 72 h (gray bars) (1108.64 ± 7.82 μg/ml). *significant differences with P1 (48 h), ▴ significant differences with P1 (72 h), ♦ significant differences with P2 (48 h), and #significant differences with P2 (72 h).
Protein concentrations for iCCM for every passage at different collection time points. There are no significant differences in the passage 3 protein concentration between 48 h (unfilled bars) (1023.22 ± 55.85 μg/ml) and 72 h (gray bars) (1108.64 ± 7.82 μg/ml). *significant differences with P1 (48 h), ▴ significant differences with P1 (72 h), ♦ significant differences with P2 (48 h), and #significant differences with P2 (72 h).

Figure 2

Morphology of BMSCs, chondrocyte and iCIM and iCCM. Arrows show the formation of aggregates. Bars represent 100 μm.
Morphology of BMSCs, chondrocyte and iCIM and iCCM. Arrows show the formation of aggregates. Bars represent 100 μm.

Figure 3

Immunofluorescence images of BMSCs, Chondrocytes, and iCIM and iCCM on days 7, 14, and 21. Cells were stained for (A) collagen 1 (green) and (B) collagen 2 (red). Nuclei were stained with DAPI (blue). Yellow bar represents 100 μm.
Immunofluorescence images of BMSCs, Chondrocytes, and iCIM and iCCM on days 7, 14, and 21. Cells were stained for (A) collagen 1 (green) and (B) collagen 2 (red). Nuclei were stained with DAPI (blue). Yellow bar represents 100 μm.

Figure 4

iCCM and chondrocytes showed positive staining for Safranin-O, indicating that the synthesis of the extracellular matrix (GAG) happened as early as day 7. (A) BMSCs, (B) Chondrocytes, (C) iCIM, (D) iCCM 25%, and (E) iCCM 50%. Bars represent 100 μm.
iCCM and chondrocytes showed positive staining for Safranin-O, indicating that the synthesis of the extracellular matrix (GAG) happened as early as day 7. (A) BMSCs, (B) Chondrocytes, (C) iCIM, (D) iCCM 25%, and (E) iCCM 50%. Bars represent 100 μm.

Figure 5

Toluidine blue staining of BMSCs, Chondrocytes, iCIM and tested groups of iCCM at days 7, 14 and 21. Bars represent 100 μm.
Toluidine blue staining of BMSCs, Chondrocytes, iCIM and tested groups of iCCM at days 7, 14 and 21. Bars represent 100 μm.

COL 2, ACP, SOX9, COL 1 and COL 10 gene expression of BMSCs, iCIM, iCCM, and chondrocytes

COL 2ACPSOX9COL 1COL 10
BMSCs0.000110 ± 0.000067*0.0279 ± 0.0377*0.000127 ± 0.000159*0.584 ± 0.181*0.000118 ± 0.000102*
iCIM0.001068 ± 0.0008820.0636 ± 0.07110.024188 ± 0.0412290.417 ± 0.4040.000268 ± 0.000212,#
iCCM0.001047 ± 0.0009290.0467 ± 0.04080.003450 ± 0.0056370.173 ± 0.2830.000736 ± 0.000183,§
Chondrocytes0.154506 ± 0.0068910.0952 ± 0.00380.544180 ± 0.0982560.160 ± 0.0280.060961 ± 0.049591

Description of the primers used in the quantitative RT-PCR analysis

GeneForward primer (5′ to 3′)Reverse primer (5′ to 3′)
COL 1AAGGCTTCAAGGTCCCCCTGGTGCAGCACCAGTAGCACCATCATTTC
COL 2GGCAATAGCAGGTTCACGTACACGATAACAGTCTTGCCCCACTT
COL XCGTCTTCAGCGCCAAGCCGCCATTCTTCACCAGATCAAA
ACPCATTCGGCGGACAAATTAGATGCCTACAAACGCAGACTACAGAA
SOX9CTGAGTCATTTGCAGTGTTTTCTCATGCTTGCATTGTTTTTGTGT
GAPDHGGCGATGCTGGCGCTGAGTACTGGTTCACACCCATGACGA
eISSN:
1875-855X
Language:
English
Publication timeframe:
6 times per year
Journal Subjects:
Medicine, Assistive Professions, Nursing, Basic Medical Science, other, Clinical Medicine