1. bookTom 66 (2022): Zeszyt 2 (June 2022)
Informacje o czasopiśmie
Pierwsze wydanie
30 Mar 2016
Częstotliwość wydawania
4 razy w roku
access type Otwarty dostęp

Molecular characteristics and genetic diversity of Fasciola hepatica from sheep in Xinjiang, China

Data publikacji: 22 Apr 2022
Tom & Zeszyt: Tom 66 (2022) - Zeszyt 2 (June 2022)
Zakres stron: 199 - 207
Otrzymano: 14 Sep 2021
Przyjęty: 18 Mar 2022
Informacje o czasopiśmie
Pierwsze wydanie
30 Mar 2016
Częstotliwość wydawania
4 razy w roku
Abstract Introduction

Fasciola hepatica is a trematode infecting ruminants worldwide and occasionally affecting other animal species, including humans. It causes significant economic losses. Geographic distribution and patterns of infection must be considered before control and management measures are developed for this parasite. DNA molecular markers are useful for the identification of flukes and elucidation of their genetic evolution. Therefore, the population structure of F. hepatica was studied using this method in sheep in Xinjiang, China.

Material and Methods

The molecular characteristics, genetic relationships within the population and dispersal patterns of F. hepatica isolates were analysed based on the cox1 and nad1 genes. The population structure of F. hepatica from three regions of Xinjiang was explored and a neutrality test was conducted.


The cox1 and nad1 genes have 21 and 42 variable sites, respectively, which can be classified into 34 and 33 haplotypes. Median-joining network and phylogenetic tree analyses showed that there was no significant variation in F. hepatica isolates between the three geographical regions. Analysis of variance revealed that the genetic variation of F. hepatica was mainly present within the populations. The neutrality test indicated that the populations were relatively stable but the Hami population may have undergone short-term expansion.


This study revealed for the first time the molecular characteristics, genetic diversity and dispersal patterns of F. hepatica isolates from sheep in Xinjiang, thus providing new insights into the genetic variation and haplotype diversity of F. hepatica from indigenous sheep.



Fascioliasis is a parasitic disease caused by the Fasciola hepatica and Fasciola gigantica trematodes and their hybrids. Fasciola hepatica is widespread in temperate regions, while F. gigantica is mainly distributed in tropical areas (20). So far, more than 70 countries have noted Fasciola spp infection. The intermediate host of the Fasciola flukes is the snail, and the main terminal hosts are sheep, cattle and goats; wildlife and humans may be involved in its transmission. Livestock are often infected via accidental ingestion of aquatic plants that carry metacercariae (30). The global prevalence of infection is estimated to be more than 250 million sheep and 350 million cattle, causing more than 3 billion dollars in annual productivity losses in the livestock industry (3). Infection with F. hepatica can cause liver damage, slow growth, and an apparent reduction in meat and milk production, which is seriously jeopardizing the healthy and stable development of the livestock industry. Although F. hepatica has been prevalent worldwide for many years, there is still insufficient detailed information on the genetic structure of populations in various regions. Therefore, understanding the molecular characteristics, population structure and diversity of genetic variation of F. hepatica is essential to control the spread of the disease.

Currently, molecular genetic techniques based on DNA analysis are used for the identification of lamellipod species and elucidation of the genetic structure of populations. Marker molecules, such as the internal ribosomal transcribed spacers (ITS1 and ITS2), the phosphoenolpyruvate carboxykinase (pepck) gene, the DNA polymerase δ (pold) gene, and the 28S rRNA and 18S rRNA genes, have been used to identify F. hepatica, F. gigantica and their ‘hybridisation’ species (14, 15, 26). In addition, mitochondrial DNA with high mutation rate, simple molecular structure and rapid evolution (7, 20), such as the NADH dehydrogenase subunit 1 (nad1) and the cytochrome c oxidase 1 (cox1) genes, have been widely used to analyse the genetic structure and dispersal pattern of F. hepatica populations (24, 25, 27).

Fascioliasis is widespread throughout China and the prevalence in animals is quite high (32). Approximately 28.5% of sheep were found to be infected with F. hepatica between 1999 and 2003 in Heilongjiang Province (29). The prevalence of this parasite in yak was 21.8–39.1% in Gansu province (34). In Guangxi province in southern China, the infection rate of F. gigantica in buffaloes is 87.35% (33). However, there are few reports of the Fasciola fluke infection in animals in Xinjiang. Xinjiang province is one of the important sheep breeding bases in northwest China and features rich natural pasture resources. At present, there are 42 million sheep in Xinjiang, most of which have been grazed mainly on pasture. In recent years, the high prevalence of fascioliasis has caused huge economic loss to the livestock industry and posed a great threat to the development of the sector of that industry which rears sheep. However, little is known about the molecular characteristics, population structure or genetic variation of F. hepatica isolates in Xinjiang, and their dispersal patterns are not yet clear. Therefore, the main purpose of this study was to investigate the level of genetic diversity and population structure of F. hepatica endemic strains in different geographical regions of Xinjiang to reveal these strains’ genetic dynamics and dispersal patterns in Xinjiang sheep. It is hoped that the knowledge obtained will provide a scientific basis for the development of reasonable management measures and control strategies to prevent the transmission of fascioliasis.

Material and Methods

Natural overview of sampling sites. Urumqi is located at the northern foot of the middle part of the Tianshan Mountains, surrounded by mountains on three sides, with extensive water resources such as the Urumqi River and over 600,000 hectares of natural pastures. Kuqa is located in the middle of the southern foot of the Tianshan Mountains and north of the Tarim Basin, an area abundant in waters such as the Tarim River, with vast forests and summer alpine pastures. Hami is located in the eastern part of Xinjiang, with a typical temperate continental climate and more virgin forests and natural pastures in the mountainous areas (Supplementary Fig. S1).

Collection of trematodes. A total of 144 worms were collected from the livers of sheep in Urumqi (Fh1–45), Kuqa (Fh46–54) and Hami (Fh55–144) regions of Xinjiang from 2016 to 2020. These flukes were washed in phosphate buffered saline (0.01M, pH 7.2–7.4) and stored in 70% alcohol at –80°C in a refrigerator for subsequent use.

Primer design and synthesis. The ITS1 gene forward F1: 5'– TTGCGCTGATTACGTCCCTG –3' and reverse R1: 5'– TTGGCTGCGCTCTTCATCGAC –3' primers were used to identify the species of the collected worms, and the cox1 gene forward F2: 5'– TTGGTTTTTTGGGCATCCT –3' and reverse R2: 5'– AGGCCACCACCAAATAAAAGA –3' and nad1 gene forward F3: 5'– AAGGATGTTGCTTTGTCGTGG –3' and reverse R3: 5'– GGAGTACGGTTACATTCACA –3' primers were used to identify the species of the collected worms. The cox1 and nad1 genes were used for genetic diversity analysis. All primers were designed by Primer Premier 5 software (Premier Biosoft, San Francisco, CA, USA) and synthesised by Shanghai Sangon Biotech (Shanghai, China).

Identification of trematodes. Following Periago’s method (21), the worms were morphologically identified by microscopy according to size, shape, whether the ‘shoulders’ were obvious, the size and position of the oral and ventral suckers, the position of the genital pore, the yolk glands and lateral branches of the intestinal canal, and the position of the excretory canal. After morphological identification, each worm tissue sample was cropped to 20 mg and ground into a pulp, and the genomic DNA of Fasciola fluke was extracted using a TaKaRa MiniBEST Universal Genomic DNA Extraction Kit (TaKaRa Bio, Dalian, China). The ITS1 sequence was amplified by PCR using the F1 and R1 primers. The amplification procedure was as follows: pre-denaturation at 94°C for 4 min, denaturation at 94°C for 40 s, annealing at 50°C for 40 s and extension at 72°C for 50 s through 35 cycles, and extension at 72°C for l0 min. The amplified product was identified by 1.5% agarose gel electrophoresis and purified using TIANgel Purification Kit (TIANGEN, China) and then sent to Shanghai Sangon Biotech for sequencing.

PCR amplification of cox1 and nad1 genes. The cox1 and nad1 genes were amplified using the F2 and R2 and F3 and R3 primers, respectively. Twenty microlitres of PCR reaction mixture were prepared, including 10 μL of double-distilled H2O, 7 μL of PCR Mixture (Thermo Fisher Scientific ,Waltham, MA, USA), 2 μL of DNA, and 0.5 μL of each forward and reverse primer. The PCR amplification procedure for the cox1 and nad1 genes was as follows: predenaturation at 94°C for 4 min, denaturation at 94°C for 40 s, annealing at 50°C (or 55°C) for 40 s and extension at 72°C for 50 s through 35 cycles, followed by extension at 72°C for 10 min. The PCR amplification products were analysed by 1.5% agarose gel electrophoresis and purified using TIANgel Purification Kit for sequencing. Each PCR product was sequenced three times. Only the sequence from identical sequencing results was used for alignment analysis.

Genetic analysis of different geographical populations of F. hepatica isolates. DNAMAN software (Lynnon Biosoft, San Ramon, CA, USA) was used to align the sequencing results, and the sequences were analysed for homology using BLAST in the NCBI database (https://www.ncbi.nlm.nih.gov). The sequences were analysed for base composition and variable sites using MEGA 7.0 software (17). The number of haplotypes, haplotype diversity (Hd), nucleotide diversity (π), average number of nucleotide differences (K) were calculated and mismatch distribution curves were generated using DnaSP software (23). Haplotype network diagrams and a neighbour-joining phylogenetic tree were constructed using PopART (19) and MEGA 7.0 software, respectively, and the genetic variation of different geographical populations of F. hepatica isolates was analysed using the analysis of variance in Arlequin version 3.5.2 software (12).


Morphological identification of parasites. These worms are flattened dorsoventrally and have a leaf-like appearance; the surface of the body is covered with dermal spines, and there is a triangular conical protrusion at the anterior end of the body with a distinct ‘shoulder’, which gradually narrows posteriorly. The oral sucker is rounded and located at the anterior end of the ventral sucker, the ventral sucker is larger than the oral sucker, and there is a genital pore between the oral and ventral suckers. There are many lateral branches in the intestines on both sides of the worm body, and the yolk glands composed of brown particles overlapping the lateral branches are distributed with excretory tubes at the rear end of the body. The parasites collected in Xinjiang, preliminarily identified as F. hepatica, were found to have an average length of 2.3 cm and width of 0.98 cm (Fig. 1).

Fig. 1

Morphological identification of parasites from sheep. A – parasites found in bile ducts of sheep; B – parasites fixed on slides with 75% alcohol after washing with phosphate buffered saline (0.01M, pH 7.2–7.4)

Molecular identification of parasites. The ITS1 gene was amplified by PCR and sequenced (Supplementary Fig. S2), and all of the collected worms were identified as F. hepatica. The PCR amplification results showed that the cox1 and nad1 genes were 496 bp and 660 bp in size, respectively (Supplementary Fig. S3), and were consistent with the expected amplification sizes. The sequence analyses based on 144 sequences of the cox1 and nad1 genes revealed that the base composition of the sequences contained significantly more A+T bases (63.8% and 62.3%, respectively) than C+G (36.2% and 37.7%, respectively), with a clear A/T preference in the sequence base composition. The cox1 gene sequences contained 21 variable sites (comprising 10 parsimony informative sites and 11 singleton sites) (Supplementary Table S1), while 42 variable sites (comprising 13 parsimony informative sites and 29 singleton sites) were harbored in the nad1 genes (Supplementary Table S2). However, there were no base insertions or deletions in any of the sequences, and only base conversions and reversals occurred.

Genetic diversity and haplotype network analysis. Genetic diversity analysis of the three populations taking 144 sequences into consideration identified 34 and 33 haplotypes based on the cox1 and nad1 genes, respectively (Table 1). The haplotype diversity (Hd) of the Urumqi (0.909 ± 0.00089) and Kuqa (0.889 ± 0.00828) populations was higher, and the nucleotide diversity (π) of the Hami population was the highest.

Genetic diversity parameters of the three geographic populations of F. hepatica

Genes Populations N h Hd K π
Urumqi 45 18 0.909 ± 0.00089 3.160 0.00637
cox1 Hami 90 23 0.890 ± 0.00047 3.280 0.00661
Kuqa 9 6 0.833 ± 0.01600 2.722 0.00549
Total 144 34 0.894 ± 0.00034 3.287 0.00663
Urumqi 45 12 0.835 ± 0.00118 2.638 0.00400
nad1 Hami 90 25 0.7590 ± 0.00218 2.778 0.00421
Kuqa 9 6 0.889 ± 0.00828 2.583 0.00391
Total 144 33 0.805 ± 0.00086 2.969 0.00450

N – number of samples; h – number of haplotypes; Hd – haplotype (gene) diversity; K – average number of nucleotide differences; π– nucleotide diversity

A haplotype network map based on the cox1 gene sequences (Fig. 2A) shows that there are 13 exclusive and 21 shared haplotypes. The dominant ones are Hap_4 and Hap_12, having and being distributed in each geographical population, and the remaining haplotypes are connected to these dominant ones by mutation. The phylogenetic tree (Fig. 3A) presents the haplotypes clustered mainly into two branches, which is consistent with the results of the haplotype network map. There are 20 shared haplotypes based on the nad1 gene in the haplotype network map (Fig. 2B), and the rest are exclusive haplotypes. The frequency of the Hap_1 haplotype is the highest, and this one dominates the network linking outwards to other haplotypes in a star shape. The phylogenetic tree (Fig. 3B) presents two branches of haplotype clustering, with individuals of different geographical origin mixed together and not grouped by geographical region, which is generally consistent with the results of the haplotype network map. The study showed that F. hepatica isolated from the three geographic populations in Xinjiang did not display significant geographic variability.

Fig. 2

Median-joining network of F. hepatica isolates based on cox1 (A) and nad1 (B) genes’ haplotypes. The size of the circle indicates the frequency of the haplotype. The colour of the circle indicates the origin of the population. The green dot represents the default vertex

Fig. 3

Phylogenetic tree of haplotypes of different geographic populations of F. hepatica in Xinjiang. The tree is based on cox1 (A) and nad1 (B) and constructed with the neighbour-joining method

Analysis of the population’s genetic structure. The results of the analysis of variance are shown in Table 2. The pairwise fixation indices ( F–statistic, – Fst)are 0.04451 and 0.03520 when targeting the cox1 and nad1 genes, respectively, and the P values are all greater than 0.05. The corresponding gene flows are 5.37 and 6.85 (31), respectively, indicating that the gene communication among the populations is sufficient and genetic differentiation is low. The respective percentages of intrapopulation genetic variation are 99.7% and 96.48%, while those of interpopulation variation are 0.3% and 3.52%, indicating that the genetic variation is mainly present within the populations rather than between them.

Molecular variation analysis based on cox1 and nad1 gene sequences

Source of variation Gene Degrees of freedom Sum of squares Variance components Percentage of variation (%)
Within cox1 141 62.933 0.44634 Vb 99.70
populations nad1 141 55.711 0.39511 Vb 96.48
Among cox1 2 0.990 0.00133 Va 0.30
populations nad1 2 1.844 0.01442 Va 3.52
Total cox1 143 63.924 0.44767
nad1 143 57.556 0.40953
F–statistic cox1 0.04451, P > 0.05
nad1 0.03520, P > 0.05

The results of the neutrality test (Table 3) showed that Tajima’s D (–1.01276, P > 0.10) and Fu’s Fs values (–19.204, P > 0.10) were not significant for the total population based on the cox1 gene, the mismatch distribution curve (Fig. 4A) was bimodal, and the test of each geographical population did not yield any indicators of significance, inferring that the populations were relatively stable and did not expand. However, the Tajima’s D (–1.92702, P < 0.05) test based on the total population of the nad1 gene was significant and the mismatch distribution curve (Fig. 4B) was single-peaked. The Tajima’s D for this gene of the Hami population reached a significant value, while this indicator and Fu’s Fs tests did not for the other two populations, suggesting that the Hami population may have deviated from the neutral theory of evolution and undergone short-term expansion.

Neutrality indices based on cox1 and nad1 genes of F. hepatica in different geographical regions of Xinjiang

Population cox1 nad1

Tajima’s D Fu’s Fs Tajima’s D Fu’s Fs
Urumqi –0.74410 –7.514 –0.72079 –2.547
Hami –0.36276 –8.659 –1.94511* –13.448
Kuqa –0.34120 –1.395 –0.55536 –1.522
Total –1.01276 –19.204 –1.92702* –19.881

*Represents significant deviation from neutrality (P < 0.05)

Fig. 4

Mismatch distribution of haplotypes of the cox1 (A) and nad1 (B) genes. The number of nucleotide differences between pairs of sequences is indicated along the x–axis, and their frequency along the y–axis. Obs – observed value; Exp – expected value


As a re-emerging neglected tropical disease, fascioliasis has become a major food safety and public health concern because of the increasing infection risks. Human fascioliasis especially has come to pose a great threat to public health. The unique biological properties of F. hepatica may be some of the factors driving its genetic diversity and shaping its population structure. Firstly, F. hepatica has not only normal spermatogenetic capability but also those of autofertilisation and cross-fertilisation. In some conditions, it can reproduce by parthenogenesis, and this particular mode of reproduction may cause changes in the allele frequencies in defined populations (10, 26, 27). Furthermore, the requirement of F. hepatica for intermediate hosts (mainly freshwater snails) and definitive hosts to complete its life cycle may also foster greater heterogeneity. Snails are a highly invasive and adaptive group of organisms with a wide range of distribution, and the potential for clonal reproduction during the asexual developmental stages of miracidia in snails, coupled with the extensive movement of definitive hosts, could facilitate the spread of F. hepatica populations and promote higher levels of gene exchange, leading to genetic diversity (4, 22, 28). In addition, adult worms of F. hepatica can survive in hosts for long periods of time, and large numbers of eggs can be excreted in feces from untreated livestock, potentially resulting in genotypic diversity of the worms. Environmental changes such as temperature, humidity, altitude and farm management may also mould the population structure of F. hepatica (1, 13).

Genetic diversity can reflect the evolutionary potential of a species. It is generally accepted that the higher the level of genetic diversity, the greater the adaptability to the environment. Currently, it has been shown that the level of diversity and population structure varies considerably between geographical regions. Bozorgomid et al. (8) analysed the genetic diversity of the nad1 gene from F. hepatica isolates from cattle, sheep and goats in Iran, and found a total of 37 haplotypes, with a high level of population genetic diversity. Beesley et al. (2) found a high level of population genetic diversity in Argentinean F. hepatica isolates and identified a total of 263 unique genotypes. Ichikawa-Seki et al. (16) revealed that 11 haplotypes belonged to a F. hepatica population and 18 haplotypes belonged to a F. gigantica population in 211 lamellipodia from partial geographical regions of China, and Beja-Pereira et al. (5) observed that the ‘hybrid Fasciola fluke’ type harboured the highest number of haplotypes and presented high haplotype diversity and nucleotide diversity values. In the present study, 34 and 33 haplotypes were detected from 144 sequences of cox1 and nad1 genes, respectively, and the Hami population had the highest number of haplotypes and the highest π and K values. The occurrence of this phenomenon in the Hami population may be related to the mild and humid climate and the presence of a large number of water-filled depressions, which provide the best environment for intermediate hosts to survive (6, 9, 11).

The median-joining network and phylogenetic trees showed that 144 F. hepatica isolates from three different geographical sources in Xinjiang were mixed and distributed without significant geographical differentiation. The analysis of variance showed that the Fst ranged from 0 to 0.05, indicating a small genetic differentiation (18). The respective proportions of intrapopulation genetic variation for cox1 and nad1 were 99.7% and 96.48%, indicating that the three geographic populations in Xinjiang had a low degree of genetic differentiation but adequate gene exchange mainly deriving from intrapopulation variation. The results of the neutrality test indicated that the populations were relatively stable but the Hami population may have undergone short-term expansion. The present study has for the first time revealed the molecular characteristics, population genetic relationships and dispersal patterns of F. hepatica in sheep in Xinjiang, China, which is of great importance for the better understanding of its genetic diversity and the developing of reasonable management measures to control sheep fascioliasis.

Fig. 1

Morphological identification of parasites from sheep. A – parasites found in bile ducts of sheep; B – parasites fixed on slides with 75% alcohol after washing with phosphate buffered saline (0.01M, pH 7.2–7.4)
Morphological identification of parasites from sheep. A – parasites found in bile ducts of sheep; B – parasites fixed on slides with 75% alcohol after washing with phosphate buffered saline (0.01M, pH 7.2–7.4)

Fig. 2

Median-joining network of F. hepatica isolates based on cox1 (A) and nad1 (B) genes’ haplotypes. The size of the circle indicates the frequency of the haplotype. The colour of the circle indicates the origin of the population. The green dot represents the default vertex
Median-joining network of F. hepatica isolates based on cox1 (A) and nad1 (B) genes’ haplotypes. The size of the circle indicates the frequency of the haplotype. The colour of the circle indicates the origin of the population. The green dot represents the default vertex

Fig. 3

Phylogenetic tree of haplotypes of different geographic populations of F. hepatica in Xinjiang. The tree is based on cox1 (A) and nad1 (B) and constructed with the neighbour-joining method
Phylogenetic tree of haplotypes of different geographic populations of F. hepatica in Xinjiang. The tree is based on cox1 (A) and nad1 (B) and constructed with the neighbour-joining method

Fig. 4

Mismatch distribution of haplotypes of the cox1 (A) and nad1 (B) genes. The number of nucleotide differences between pairs of sequences is indicated along the x–axis, and their frequency along the y–axis. Obs – observed value; Exp – expected value
Mismatch distribution of haplotypes of the cox1 (A) and nad1 (B) genes. The number of nucleotide differences between pairs of sequences is indicated along the x–axis, and their frequency along the y–axis. Obs – observed value; Exp – expected value

Molecular variation analysis based on cox1 and nad1 gene sequences

Source of variation Gene Degrees of freedom Sum of squares Variance components Percentage of variation (%)
Within cox1 141 62.933 0.44634 Vb 99.70
populations nad1 141 55.711 0.39511 Vb 96.48
Among cox1 2 0.990 0.00133 Va 0.30
populations nad1 2 1.844 0.01442 Va 3.52
Total cox1 143 63.924 0.44767
nad1 143 57.556 0.40953
F–statistic cox1 0.04451, P > 0.05
nad1 0.03520, P > 0.05

Genetic diversity parameters of the three geographic populations of F. hepatica

Genes Populations N h Hd K π
Urumqi 45 18 0.909 ± 0.00089 3.160 0.00637
cox1 Hami 90 23 0.890 ± 0.00047 3.280 0.00661
Kuqa 9 6 0.833 ± 0.01600 2.722 0.00549
Total 144 34 0.894 ± 0.00034 3.287 0.00663
Urumqi 45 12 0.835 ± 0.00118 2.638 0.00400
nad1 Hami 90 25 0.7590 ± 0.00218 2.778 0.00421
Kuqa 9 6 0.889 ± 0.00828 2.583 0.00391
Total 144 33 0.805 ± 0.00086 2.969 0.00450

Neutrality indices based on cox1 and nad1 genes of F. hepatica in different geographical regions of Xinjiang

Population cox1 nad1

Tajima’s D Fu’s Fs Tajima’s D Fu’s Fs
Urumqi –0.74410 –7.514 –0.72079 –2.547
Hami –0.36276 –8.659 –1.94511* –13.448
Kuqa –0.34120 –1.395 –0.55536 –1.522
Total –1.01276 –19.204 –1.92702* –19.881

Afshan K., Fortes-Lima C.A., Artigas P., Valero A.M., Qayyum M., Mas-Coma S.: Impact of climate change and man-made irrigation systems on the transmission risk, long-term trend and seasonality of human and animal fascioliasis in Pakistan. Geospat Health 2014, 8, 317–334, doi: 10.4081/gh.2014.22. Afshan K. Fortes-Lima C.A. Artigas P. Valero A.M. Qayyum M. Mas-Coma S. Impact of climate change and man-made irrigation systems on the transmission risk, long-term trend and seasonality of human and animal fascioliasis in Pakistan Geospat Health 2014 8 317 334 10.4081/gh.2014.22Otwórz DOISearch in Google Scholar

Beesley N.J., Attree E., Vázquez-Prieto S., Vilas R., Paniagua E., Ubeira F.M., Jensen O., Pruzzo C., Álvarez J.D., Malandrini J.B., Solana H., Hodgkinson J.E.: Evidence of population structuring following population genetic analyses of Fasciola hepatica from Argentina. Int J Parasitol 2021, 51, 471–480, doi: 10.1016/j.ijpara.2020.11.007. Beesley N.J. Attree E. Vázquez-Prieto S. Vilas R. Paniagua E. Ubeira F.M. Jensen O. Pruzzo C. Álvarez J.D. Malandrini J.B. Solana H. Hodgkinson J.E. Evidence of population structuring following population genetic analyses of Fasciola hepatica from Argentina Int J Parasitol 2021 51 471 480 10.1016/j.ijpara.2020.11.007Otwórz DOISearch in Google Scholar

Beesley N.J., Caminade C., Charlier J., Flynn R.J., Hodgkinson J.E., Martinez-Moreno A., Martinez-Valladares M., Perez J., Rinaldi L., Williams D.J.L.: Fasciola and fasciolosis in ruminants in Europe: Identifying research needs. Transbound Emerg Dis 2018, 65 (Suppl 1), 199–216, doi: 10.1111/tbed.12682. Beesley N.J. Caminade C. Charlier J. Flynn R.J. Hodgkinson J.E. Martinez-Moreno A. Martinez-Valladares M. Perez J. Rinaldi L. Williams D.J.L. Fasciola and fasciolosis in ruminants in Europe: Identifying research needs Transbound Emerg Dis 2018 65 Suppl 1 199 216 10.1111/tbed.12682Otwórz DOISearch in Google Scholar

Beesley N.J., Williams D.J.L., Paterson S., Hodgkinson J.: Fasciola hepatica demonstrates high levels of genetic diversity, a lack of population structure and high gene flow: possible implications for drug resistance. Int J Parasitol 2017, 47, 11–20, doi: 10.1016/j.ijpara.2016.09.007. Beesley N.J. Williams D.J.L. Paterson S. Hodgkinson J. Fasciola hepatica demonstrates high levels of genetic diversity, a lack of population structure and high gene flow: possible implications for drug resistance Int J Parasitol 2017 47 11 20 10.1016/j.ijpara.2016.09.007Otwórz DOISearch in Google Scholar

Beja-Pereira A., Caramelli D., Lalueza-Fox C., Vernesi C., Ferrand N., Casoli A., Goyache F., Royo L.J., Conti S., Lari M., Martini A., Ouragh L., Magid A., Atash A., Zsolnai A., Boscato P., Triantaphylidis C., Ploumi K., Sineo L., Mallegni F., Taberlet P., Erhardt G., Sampietro L., Bertranpetit J., Barbujani G., Luikart G., Bertorelle G.: The origin of European cattle: evidence from modern and ancient DNA. Proc Natl Acad Sci USA 2006, 103, 8113–8118, doi: 10.1073/pnas.0509210103. Beja-Pereira A. Caramelli D. Lalueza-Fox C. Vernesi C. Ferrand N. Casoli A. Goyache F. Royo L.J. Conti S. Lari M. Martini A. Ouragh L. Magid A. Atash A. Zsolnai A. Boscato P. Triantaphylidis C. Ploumi K. Sineo L. Mallegni F. Taberlet P. Erhardt G. Sampietro L. Bertranpetit J. Barbujani G. Luikart G. Bertorelle G. The origin of European cattle: evidence from modern and ancient DNA Proc Natl Acad Sci USA 2006 103 8113 8118 10.1073/pnas.0509210103Otwórz DOISearch in Google Scholar

Bennema S.C., Molento M.B., Scholte R.G., Carvalho O.S., Pritsch I.: Modelling the spatial distribution of Fasciola hepatica in bovines using decision tree, logistic regression and GIS query approaches for Brazil. Parasitology 2017, 144, 1677–1685, doi: 10.1017/S0031182017000786. Bennema S.C. Molento M.B. Scholte R.G. Carvalho O.S. Pritsch I. Modelling the spatial distribution of Fasciola hepatica in bovines using decision tree, logistic regression and GIS query approaches for Brazil Parasitology 2017 144 1677 1685 10.1017/S0031182017000786Otwórz DOISearch in Google Scholar

Blair D., Campos A., Cummings M.P., Laclette J.P.: Evolutionary biology of parasitic platyhelminths: The role of molecular phylogenetics. Parasitol Today 1996, 12, 66–71, doi: 10.1016/0169–4758(96)80657-0. Blair D. Campos A. Cummings M.P. Laclette J.P. Evolutionary biology of parasitic platyhelminths: The role of molecular phylogenetics Parasitol Today 1996 12 66 71 10.1016/0169–4758(96)80657-0Otwórz DOISearch in Google Scholar

Bozorgomid A., Rouhani S., Harandi M.F., Ichikawa-Seki M., Raeghi S.: Genetic diversity and distribution of Fasciola hepatica haplotypes in Iran: Molecular and phylogenetic studies. Vet Parasitol Reg Stud Rep 2020, 19, 100359, doi: 10.1016/j.vprsr.2019.100359. Bozorgomid A. Rouhani S. Harandi M.F. Ichikawa-Seki M. Raeghi S. Genetic diversity and distribution of Fasciola hepatica haplotypes in Iran: Molecular and phylogenetic studies Vet Parasitol Reg Stud Rep 2020 19 100359 10.1016/j.vprsr.2019.10035932057386Otwórz DOISearch in Google Scholar

Charlier J., Ghebretinsae A.H., Levecke B., Ducheyne E., Claerebout E., Vercruysse J.: Climate- driven longitudinal trends in pasture-borne helminth infections of dairy cattle. Int J Parasitol 2016, 46, 881–888, doi: 10.1016/ j.ijpara.2016.09.001. Charlier J. Ghebretinsae A.H. Levecke B. Ducheyne E. Claerebout E. Vercruysse J. Climate- driven longitudinal trends in pasture-borne helminth infections of dairy cattle Int J Parasitol 2016 46 881 888 10.1016/ j.ijpara.2016.09.001Otwórz DOISearch in Google Scholar

Cwiklinski K., O'Neill S.M., Donnelly S., Dalton J.P.: A prospective view of animal and human Fasciolosis. Parasite Immunol 2016, 38, 558–568, doi: 10.1111/pim.12343. Cwiklinski K. O'Neill S.M. Donnelly S. Dalton J.P. A prospective view of animal and human Fasciolosis Parasite Immunol 2016 38 558 568 10.1111/pim.12343505325727314903Otwórz DOISearch in Google Scholar

Dutra L.H., Molento M.B., Naumann C.R., Biondo A.W., Fortes F.S., Savio D., Malone J.B.: Mapping risk of bovine fasciolosis in the south of Brazil using Geographic Information Systems. Vet Parasitol 2010, 169, 76–81, doi: 10.1016/j.vetpar.2009.12.015. Dutra L.H. Molento M.B. Naumann C.R. Biondo A.W. Fortes F.S. Savio D. Malone J.B. Mapping risk of bovine fasciolosis in the south of Brazil using Geographic Information Systems Vet Parasitol 2010 169 76 81 10.1016/j.vetpar.2009.12.015Otwórz DOISearch in Google Scholar

Excoffier L., Lischer H.E.L.: Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Mol Ecol Resour 2010, 10, 564–567, doi:10.1111/j.1755-0998.2010.02847.x. Excoffier L. Lischer H.E.L. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows Mol Ecol Resour 2010 10 564 567 10.1111/j.1755-0998.2010.02847.xOtwórz DOISearch in Google Scholar

Grillo V., Jackson F., Cabaret J., Gilleard J.S.: Population genetic analysis of the ovine parasitic nematode Teladorsagia circumcincta and evidence for a cryptic species. Int J Parasitol 2007, 37, 435–447, doi: 10.1016/j.ijpara.2006.11.014. Grillo V. Jackson F. Cabaret J. Gilleard J.S. Population genetic analysis of the ovine parasitic nematode Teladorsagia circumcincta and evidence for a cryptic species Int J Parasitol 2007 37 435 447 10.1016/j.ijpara.2006.11.014Otwórz DOISearch in Google Scholar

Hayashi K., Ichikawa-Seki M., Mohanta U.K., Shoriki T., Chaichanasak P., Itagaki T.: Hybrid origin of Asian aspermic Fasciola flukes is confirmed by analyzing two single-copy genes, pepck and pold. J Vet Med Sci 2018, 80, 98–102, doi: 10.1292/jvms.17-0406. Hayashi K. Ichikawa-Seki M. Mohanta U.K. Shoriki T. Chaichanasak P. Itagaki T. Hybrid origin of Asian aspermic Fasciola flukes is confirmed by analyzing two single-copy genes, pepck and pold J Vet Med Sci 2018 80 98 102 10.1292/jvms.17-0406Otwórz DOISearch in Google Scholar

Husch C., Sattmann H., Haefeli I., Prosl H., Walochnik J.: Genetic diversity of Fasciola hepatica in Austria. Parasitol Res 2020, 119, 1697–1701, doi: 10.1007/s00436-020-06633-3. Husch C. Sattmann H. Haefeli I. Prosl H. Walochnik J. Genetic diversity of Fasciola hepatica in Austria Parasitol Res 2020 119 1697 1701 10.1007/s00436-020-06633-3Otwórz DOISearch in Google Scholar

Ichikawa-Seki M., Peng M., Hayashi K., Shoriki T., Mohanta U.K., Shibahara T., Itagaki T.: Nuclear and mitochondrial DNA analysis reveals that hybridization between Fasciola hepatica and Fasciola gigantica occurred in China. Parasitology 2017, 144, 206–213, doi: 10.1017/S003118201600161X. Ichikawa-Seki M. Peng M. Hayashi K. Shoriki T. Mohanta U.K. Shibahara T. Itagaki T. Nuclear and mitochondrial DNA analysis reveals that hybridization between Fasciola hepatica and Fasciola gigantica occurred in China Parasitology 2017 144 206 213 10.1017/S003118201600161XOtwórz DOISearch in Google Scholar

Kumar S., Stecher G., Tamura K.: MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol Biol Evol 2016, 33, 1870–1874, doi: 10.1093/molbev/msw054. Kumar S. Stecher G. Tamura K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets Mol Biol Evol 2016 33 1870 1874 10.1093/molbev/msw054Otwórz DOISearch in Google Scholar

Larrañaga N., Mejía R.E., Hormaza J.I., Montoya A., Soto A., Fontecha G.A.: Genetic structure of Plasmodium falciparum populations across the Honduras-Nicaragua border. Malar J 2013, 12, 354, doi:10.1186/1475-2875-12-354. Larrañaga N. Mejía R.E. Hormaza J.I. Montoya A. Soto A. Fontecha G.A. Genetic structure of Plasmodium falciparum populations across the Honduras-Nicaragua border Malar J 2013 12 354 10.1186/1475-2875-12-354Otwórz DOISearch in Google Scholar

Leigh J.W., Bryant D.: PopART: Full-feature software for haplotype network construction. Methods Ecol Evol 2015, 6, 1110–1116, doi: 10.1111/2041-210X.12410. Leigh J.W. Bryant D. PopART: Full-feature software for haplotype network construction Methods Ecol Evol 2015 6 1110 1116 10.1111/2041-210X.12410Otwórz DOISearch in Google Scholar

Mas-Coma S., Valero M.A., Bargues M.D.: Chapter 2. Fasciola, lymnaeids and human fascioliasis, with a global overview on disease transmission, epidemiology, evolutionary genetics, molecular epidemiology and control. Adv Parasitol 2009, 69, 41–146, doi: 10.1016/S0065-308X(09)69 002-3. Mas-Coma S. Valero M.A. Bargues M.D. Chapter 2 Fasciola, lymnaeids and human fascioliasis, with a global overview on disease transmission, epidemiology, evolutionary genetics, molecular epidemiology and control. Adv Parasitol 2009 69 41 146 10.1016/S0065-308X(09)69 002-3Otwórz DOISearch in Google Scholar

Periago M.V., Valero M.A., El Sayed M., Ashrafi K., El Wakeel A., Mohamed M.Y., Desquesnes M., Curtale F., Mas-Coma S.: First phenotypic description of Fasciola hepatica/Fasciola gigantica intermediate forms from the human endemic area of the Nile Delta, Egypt. Infect Genet Evol 2008, 8, 51–58, doi: 10.1016/j.meegid.2007.10.001. Periago M.V. Valero M.A. El Sayed M. Ashrafi K. El Wakeel A. Mohamed M.Y. Desquesnes M. Curtale F. Mas-Coma S. First phenotypic description of Fasciola hepatica/Fasciola gigantica intermediate forms from the human endemic area of the Nile Delta, Egypt Infect Genet Evol 2008 8 51 58 10.1016/j.meegid.2007.10.00118006385Otwórz DOISearch in Google Scholar

Prugnolle F., Liu H., de Meeûs T., Balloux F.: Population genetics of complex life-cycle parasites: an illustration with trematodes. Int J Parasitol 2005, 35, 255–263doi:10.1016/j.ijpara.2004.10.027. Prugnolle F. Liu H. de Meeûs T. Balloux F. Population genetics of complex life-cycle parasites: an illustration with trematodes Int J Parasitol 2005 35 255 26310.1016/j.ijpara.2004.10.02715722077Otwórz DOISearch in Google Scholar

Rozas J., Ferrer-Mata A., Sánchez-DelBarrio J.C., Guirao-Rico S., Librado P., Ramos-Onsins S.E., Sánchez-Gracia A.: DnaSP 6: DNA Sequence Polymorphism Analysis of Large Data Sets. Mol Biol Evol 2017, 34, 3299–3302, doi: 10.1093/molbev/msx248. Rozas J. Ferrer-Mata A. Sánchez-DelBarrio J.C. Guirao-Rico S. Librado P. Ramos-Onsins S.E. Sánchez-Gracia A. DnaSP 6: DNA Sequence Polymorphism Analysis of Large Data Sets Mol Biol Evol 2017 34 3299 3302 10.1093/molbev/msx24829029172Otwórz DOISearch in Google Scholar

Schwantes J.B., Quevedo P., D'Ávila M.F., Molento M.B., Graichen D.A.S.: Fasciola hepatica in Brazil: genetic diversity provides insights into its origin and geographic dispersion. J Helminthol 2020, 94, e83, doi:10.1017/S0022149X19000774. Schwantes J.B. Quevedo P. D'Ávila M.F. Molento M.B. Graichen D.A.S. Fasciola hepatica in Brazil: genetic diversity provides insights into its origin and geographic dispersion J Helminthol 2020 94 e83 10.1017/S0022149X1900077431495340Otwórz DOISearch in Google Scholar

Semyenova S.K., Morozova E.V., Chrisanfova G.G., Gorokhov V.V., Arkhipov I.A., Moskvin A.S., Movsessyan S.O., Ryskov A.P.: Genetic differentiation in eastern European and western Asian populations of the liver fluke, Fasciola hepatica, as revealed by mitochondrial nad1 and cox1 genes. J Parasitol 2006, 92, 525–530, doi: 10.1645/GE-673R.1. Semyenova S.K. Morozova E.V. Chrisanfova G.G. Gorokhov V.V. Arkhipov I.A. Moskvin A.S. Movsessyan S.O. Ryskov A.P. Genetic differentiation in eastern European and western Asian populations of the liver fluke, Fasciola hepatica, as revealed by mitochondrial nad1 and cox1 genes J Parasitol 2006 92 525 530 10.1645/GE-673R.116883995Otwórz DOISearch in Google Scholar

Shoriki T., Ichikawa-Seki M., Suganuma K., Naito I., Hayashi K., Nakao M., Aita J., Mohanta U.K., Inoue N., Murakami K., Itagaki T.: Novel methods for the molecular discrimination of Fasciola spp. on the basis of nuclear protein-coding genes. Parasitol Int 2016, 65, 180–183, doi: 10.1016/j.parint.2015.12.002. Shoriki T. Ichikawa-Seki M. Suganuma K. Naito I. Hayashi K. Nakao M. Aita J. Mohanta U.K. Inoue N. Murakami K. Itagaki T. Novel methods for the molecular discrimination of Fasciola spp on the basis of nuclear protein-coding genes. Parasitol Int 2016 65 180 183 10.1016/j.parint.2015.12.00226680160Otwórz DOISearch in Google Scholar

Thang T.N., Vázquez-Prieto S., Vilas R., Paniagua E., Ubeira F.M., Ichikawa-Seki M.: Genetic diversity of Fasciola hepatica in Spain and Peru. Parasitol Int 2020, 76, 102100, doi: 10.1016/j.parint.2020.102100. Thang T.N. Vázquez-Prieto S. Vilas R. Paniagua E. Ubeira F.M. Ichikawa-Seki M. Genetic diversity of Fasciola hepatica in Spain and Peru Parasitol Int 2020 76 102100 10.1016/j.parint.2020.10210032145389Otwórz DOISearch in Google Scholar

Vignoles P., Ménard A., Rondelaud D., Agoulon A., Dreyfuss G.: Fasciola hepatica: the growth and larval productivity of redial generations in Galba truncatula subjected to miracidia differing in their mammalian origin. J Parasitol 2004, 90, 430–433, doi: 10.1645/GE-2682RN. Vignoles P. Ménard A. Rondelaud D. Agoulon A. Dreyfuss G. Fasciola hepatica: the growth and larval productivity of redial generations in Galba truncatula subjected to miracidia differing in their mammalian origin J Parasitol 2004 90 430 433 10.1645/GE-2682RN15165078Otwórz DOISearch in Google Scholar

Wang C.-R., Qiu J.-H., Zhu X.-Q., Han X.-H., Ni H.-B., Zhao J.-P., Zhou Q.-M., Zhang H.-W., Lun Z.-R.: Survey of helminths in adult sheep in Heilongjiang Province, People’s Republic of China. Vet Parasitol 2006, 140, 378–382, doi: 10.1016/j.vetpar.2006.04.008. Wang C.-R. Qiu J.-H. Zhu X.-Q. Han X.-H. Ni H.-B. Zhao J.-P. Zhou Q.-M. Zhang H.-W. Lun Z.-R. Survey of helminths in adult sheep in Heilongjiang Province, People’s Republic of China Vet Parasitol 2006 140 378 382 10.1016/j.vetpar.2006.04.00816713098Otwórz DOISearch in Google Scholar

Webb C.M., Cabada M.M.: Recent developments in the epidemiology, diagnosis, and treatment of Fasciola infection. Curr Opin Infect Dis 2018, 31, 409–414, doi: 10.1097/QCO.0000000000000482. Webb C.M. Cabada M.M. Recent developments in the epidemiology, diagnosis, and treatment of Fasciola infection Curr Opin Infect Dis 2018 31 409 414 10.1097/QCO.000000000000048230113327Otwórz DOISearch in Google Scholar

Wright S.: The genetical structure of populations. Ann Eugen 1951, 15, 323–354, doi: 10.1111/j.1469-1809.1949.tb02451.x. Wright S. The genetical structure of populations Ann Eugen 1951 15 323 354 10.1111/j.1469-1809.1949.tb02451.x24540312Otwórz DOISearch in Google Scholar

Yuan W., Liu J.-M., Lu K., Li H., Duan M.-M., Feng J.-T., Hong Y., Liu Y.-P., Zhou Y., Tong L.-B., Lu J., Zhu C.-G., Jin Y.-M., Cheng G.-F., Lin J.-J.: Molecular identification and seasonal infections of species of Fasciola in ruminants from two provinces in China. J Helminthol 2016, 90, 359–363, doi: 10.1017/S0022149X15000383. Yuan W. Liu J.-M. Lu K. Li H. Duan M.-M. Feng J.-T. Hong Y. Liu Y.-P. Zhou Y. Tong L.-B. Lu J. Zhu C.-G. Jin Y.-M. Cheng G.-F. Lin J.-J. Molecular identification and seasonal infections of species of Fasciola in ruminants from two provinces in China J Helminthol 2016 90 359 363 10.1017/S0022149X1500038326123576Otwórz DOISearch in Google Scholar

Zhang J.-L., Si H.-F., Zhou X.-Z., Shang X.-F., Li B., Zhang J.-Y.: High prevalence of fasciolosis and evaluation of the efficacy of anthelmintics against Fasciola hepatica in buffaloes in Guangxi, China. Int J Parasitol Parasites Wildl 2019, 8, 82–87, doi: 10.1016/j.ijppaw.2018.12.010. Zhang J.-L. Si H.-F. Zhou X.-Z. Shang X.-F. Li B. Zhang J.-Y. High prevalence of fasciolosis and evaluation of the efficacy of anthelmintics against Fasciola hepatica in buffaloes in Guangxi, China Int J Parasitol Parasites Wildl 2019 8 82 87 10.1016/j.ijppaw.2018.12.010633038030671343Otwórz DOISearch in Google Scholar

Zhang X.-X., Feng S.-Y., Ma J.-G., Zheng W.-B., Yin M.-Y., Qin S.-Y., Zhou D.-H., Zhao Q., Zhu X.-Q.: Seroprevalence and risk factors of fascioliasis in yaks, Bos grunniens, from three counties of Gansu Province, China. Korean J Parasitol 2017, 55, 89–93, doi: 10.3347/kjp.2017.55.1.89. Zhang X.-X. Feng S.-Y. Ma J.-G. Zheng W.-B. Yin M.-Y. Qin S.-Y. Zhou D.-H. Zhao Q. Zhu X.-Q. Seroprevalence and risk factors of fascioliasis in yaks, Bos grunniens, from three counties of Gansu Province, China Korean J Parasitol 2017 55 89 93 10.3347/kjp.2017.55.1.89536527028285513Otwórz DOISearch in Google Scholar

Polecane artykuły z Trend MD

Zaplanuj zdalną konferencję ze Sciendo