The synthesis of UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase (GNE), α-dystroglycan, and β-galactoside α-2,3-sialyltransferase 6 (ST3Gal6) by skeletal muscle cell as a response to infection with

R. Milcheva; K. Todorova; A. Georgieva; S. Petkova

Détails du journal et du numéro

Helminthologia

Détails du magazine

Format: Magazine
eISSN: 1336-9083
Première parution: 22 Apr 2006
Périodicité: 4 fois par an
Langues: Anglais

Trichinellosis is a food-borne parasitosis caused by nematodes from the Trichinella genus (Railliet, 1985). The disease results after consumption of undercooked meat contaminated with infectious Trichinella larvae, which reach maturity to adult species of the parasites in the small intestine and reproduce. The newborn larvae travel all over the host body via the blood and the lymphatic system, but can successfully invade only the striated muscle cells. After penetrating the sarcolemma, the larva induces dramatic genetic, morphological and functional changes into the occupied portion of muscle fiber that eventually result in a completely new structure called a Nurse cell, capable of supporting the parasite for years. Even if the newly formed cytoplasm had fully lost its contractile capabilities, the Nurse cell remains well integrated within the surrounding unaffected muscle tissue, capable of supporting the parasite for years (Despommier, 1998).

Sialic acids are over than 40 modifications of the neuraminic acid, which derives from N-acetyl mannosamine. The process of sialylation of glycoproteins and glycolipids always occurs into the Golgi and afterwards they are transported to the cell membrane. Because of their terminal position on the carbohydrate chains, the sialic acids participate in almost all types of recognition phenomena and adhesion mechanisms (Varki, 1997). The sialic acids are transferred onto a penultimate sugar residue of a nascent oligosaccharide composition via α-2,3-, α-2,6- or α-2,8-glycosidic bond through enzymes, belonging to different sialyltransferase families (Takashima, 2008). In skeletal muscles, the sialic acids are important for the functional maintenance of glycoproteins involved in muscle excitability (Johnson et al., 2004; Schwetz et al., 2011), cell structure and neuromuscular junctions (McDearmon et al., 2003; Combs & Ervasti, 2005), muscle development and regeneration (Broccolini et al., 2008), and exercise performance (Hanish et al., 2013).

We already reported a positive reaction towards the lectin Maackia amurensis II (MAL II) as a permanent characteristic of the cytoplasm of the developing and the mature Nurse cell of Trichinella spiralis (Owen, 1835), suggesting a novel biosynthesis of α-2,3-sialylated glycoproteins (Milcheva et al., 2020). This suggestion was in accordance to our previous findings of increased levels of free and protein bound sialic acid and elevated total sialyltransferase activity in mice muscles, invaded with T. spiralis (Milcheva et al., 2015). Therefore, an up-regulation of the enzyme UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase (GNE), which is the key initiator and regulator of the sialic acids biosynthesis (Hinderlich et al., 1997), is inevitably expected. On the other hand, the only identified sialylated glycoprotein in skeletal muscles by now is the α-dystroglycan, bearing a sialyl-α-2,3-Gal-β-1,4-GlcNAc-β-1,2-Man-α-1-O-Ser/Thr glycan (Barresi & Campbell, 2006). This glycoprotein is an important member of the dystrophin-associated glycoprotein complex, representing a physical link between the cytoskeleton and basement membrane, and thus providing a structural stability to the sarcolemma (Petrof et al., 1993). The role of this glycoprotein for the Nurse cell of T. spirallis would be particularly interesting in the light of the fact that after invasion the occupied portion of the muscle fiber loses its contractile properties, but it still remains well integrated within the surrounding non-invaded tissue. A third and very important matter concerns the expression of enzymes from the β-galactoside α-2,3-sialyltransferase family (ST3Gal), involved in the biosynthesis of α-2,3-sialylated oligosaccharide components. One of the members of this family, the enzyme ST3Gal3, transfers sialic acid preferably onto Gal-β-1,4-GlcNAc as an acceptor (Takashima, 2008) – a fact that makes it a suitable candidate in the sialylation of the oligosaccharide of α-dystroglycan.

Based on this hypothesis, the present work was designed to investigate the expressions of GNE, α-dystroglycan and ST3Gal6 sialyltransferse in mouse skeletal muscles, after invasion by T. spiralis.

Material and Methods

Parasites, invasion, sample collection and tissue preparation

Infective Trichinella spiralis larvae (code ISS03) were isolated from previously invaded laboratory albino mice (Mus musculus musculus), between 30^th and 40^th day post infection (d.p.i.) according to a routine protocol, as already described (Milcheva et al., 2019). Fifteen male mice, 6 – 8 weeks old, were inoculated with 500 infective T. spiralis larvae per os. The animals (five per group) were humanly euthanized at day 0, 14 and 35 post infection (d.p.i.) and skeletal muscle specimens (front and hind limbs, pectoral and gluteal muscles) were excised and fixed with freshly prepared modified methacarn fixative according to Cox et al. (2006). After processing the specimens were embedded in paraffin.

Immunohistochemistry

Parallel tissue sections, 5 μm thick, were submitted to an antigen retrieval step with 10 mM Citrate buffer pH 6.2 for 5 min at sub-boiling temperature in microwave oven. The endogenious peroxidase activity was blocked by 0.3 % solution of H₂O₂, and then 2.5 % normal goat serum (Vector Laboratories Ltd, Burlingame, CA, USA) was used to prevent non-specific antigen activity. Rabbit polyclonal antibodies against -N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase (GNE, dilution 1:100), α-dystroglycan (dilution 1:500, both purchased from Abcam, Cambridge, UK) and β-galactoside α-2,3-sialyltransferase 6 (ST3Gal6, dilution 1:200, Sigma-Aldrich, St. Louis, MO, USA) were applied overnight at 4°C. The sections were then treated with a secondary antibody (ImmPress HRP anti-rabbit IgG polymer detection kit, Vector Laboratories) for 30 min, a color reaction was developed with DAB Peroxidase (HRP) Substrate Kit (Vector Laboratories) and the sections were counterstained with hematoxylin. The immunohistochemical staining was evaluated as negative (-) and positive (+). Additional sections were routinely stained with hematoxylin and eosin (H&E) for basic morphological evaluation.

Molecular biology studies

The experiments described below were designed to evaluate the expression of mRNA of mouse UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase (Gne), dystroglycan 1 (Dag 1) and β-galactoside α-2,3-sialyltransferase 6 (St3gal6) by real time RT-PCR in tissue sections from mouse skeletal muscle collected at days 0, 14 and 35 d.p.i. The levels of expressions were estimated via normalization versus the expression of glyceraldehyde 3-phosphate dehydrogenase (Gapdh) as a reference gene. The infection of the samples was confirmed by end point PCR of the Expansion segment V (ESV) of T. spiralis (Zarlenga et al., 2001). The primers used for gene expression analyzes were designed using the NCBI Blast Tool (Ye et al., 2012) in a way to span at least one intron sequence. The full names of investigated genes, the accession numbers of their reference sequences, the primer sequences and the size of the amplified products are shown in Table 1. The oligonucleotides were purchased from HVD Biotech Vertriebs (Vienna, Austria).

Table 1

The full names of the investigated genes and their primers sequences used in this study.

Gene	Abbreviation	Species	Accession number	Primers sequences (5`-3`)	Product size (bp)
Glyceraldehyde 3-phosphate dehydrogenase	Gapdh	Mus musculus	NM_001289726, transcript variant 1	TCCTCGTCCCGTAGACAAAATG –F AATCTCCACTTTGCCACTGC – R	103
Glucosamine (UDP-N- acetyl) – 2 – epimerase/N- acetylmannosamine kinase	Gne	Mus musculus	NM_015828.3	AATCCTGCAGATGTGTGTGG –F AATGCAGCACAACTCCTTCC – R	119
Dystroglycan 1	Dag1	Mus musculus	NM_001276485.1, transcript variant 5	GTTGGCATTCCAGACGGTAC –F AGTGTAGCCAAGACGGTAAGG – R	136
ST3 beta-galactoside alpha- 2,3-sialyltransferase 6	St3gal6	Mus musculus	NM_018784.2	TCCCAGCTGAAGAAATGAGGAC –F TCAGCTCTGCACAGAAATGG – R	112
Expansion segment V	ESV	Trichinella spiralis	*	GTTCCATGTGAACAGCAGT –F CGAAAACATACGACAACTGC – R	173

*Zarlenga et al., 2001

Isolation of gDNA and end point PCR

Genomic DNA from six paraffin sections from all samples was isolated using QIAamp DNA FFPE Tissue Kit (Qiagen, Hilden Germany). Genomic DNA from T. spiralis infectious larvae was isolated as a positive control, using NZY Tissue gDNA Isolation Kit (NZY-Tech, Lisboa, Portugal). All isolations were performed according to the provided protocols of the producers. The yield and purity of the collected gDNA were measured using S-300 Spectrophotometer (Boeco, Hamburg, Germany). Hot start PCR was designed on approximately 100 ng gDNA as a template by using Veriti thermoblock (Applied Biosystems of Thermo Fisher Scientific), as already described in details (Milcheva et al., 2019). The products of amplification were visualized on 2.5 % agarose gel supplemented with Simply Safe nucleic acid stain (EurX®, Gdansk, Poland) versus 100-1000 bp DNA Ladder (EurX) and the gels were photographed with a gel documentation system Vision (Scie-Plas Ltd, Cambridge, UK).

Gene expression analyses

Total RNA from six paraffin sections from all samples was isolated using RNeasy FFPE Kit (Qiagen), according to the provided protocol. The yield and purity of the collected RNA were measured using S-300 Spectrophotometer (Boeco). Approximately 2 μg total RNA from each sample were used for first strand cDNA synthesis, as already described (Milcheva et al., 2019). The generated cDNA was quantified and the samples were stored at -80°C.

Real-time PCR was designed on 1 μl of RT-product, containing approximately 500 ng cDNA as a template, in 20 μl total volume of reaction using RotorGene SYBR Green PCR Kit (Qiagen) following the recommendations of the producer. Three real-time PCR reactions/sample in triplicate were performed for amplification of Gapdh, Gne, Dag1 and St3gal6 using RotorGene™ 6000 Real-time Analyzer (Corbett Life Science-Qiagen). The data were analyzed using Rotor Gene Q Series Software (Qiagen) and the relative quantification of the sialyltransferase expressions was calculated by the ΔΔCt method (Zhang et al., 2014) versus Gapdh as reference genes. After each run, a High Resolution Melting Curve Analysis (HRM) was performed to verify the specificity of the amplified products, which were visualized on 2.5 % agarose gel supplemented with Simply Safe nucleic acid stain (EurX) versus 100 – 1000 bp DNA Ladder (EurX) and the gels were photographed with a gel documentation system Vision (Scie-Plas Ltd, Cambridge, UK).

Statistical analysis of the gene expression quantification

Statistical analysis of the data was performed using GraphPad Prism 5.03 software (San Diego, CA, USA). Non-parametric one-way analysis of variance (Kruskal-Wallis test) with Dunn`s Multiple Comparison Test (significance level 0.05) was computed to detect statistically significant differences between the Ct values of the qPCR products between the control and infected samples, and the results were interpreted as follows: P < 0.001 = highly significant, P < 0.01 = very significant, P < 0.05 = significant.

Ethical Approval and/or Informed Consent

All animal experiments were performed in a compliance of Regulation № 20/01.11.2012 on the minimum requirements for protection and welfare of experimental animals and the requirements for the sites for their use, breeding and / or delivery, issued by the Ministry of Agriculture and Food of Republic of Bulgaria.

Results

Expressions of GNE, α-dystroglycan and ST3Gal6 proteins are increased in skeletal muscle fibers occupied by T. spiralis

The routine histology showed the typical features of Trichinella infection including centralized enlarged nuclei with disintegrated sarcoplasm at day 14. p.i. and a completed Nurse cell encompassing the grown and developed larva at day 35 p.i. (Fig. 1). Immunohistochemical analysis demonstrated strongly positive immunoreactivity with GNE, α-dystroglycan and ST3Gal6 antibodies with sarcoplasmic localization in the occupied skeletal muscle cells (Fig. 1). The increased expressions of the three proteins were observed in both investigated time points of Nurse cell development. Intensive expressions of the three proteins of interest were absent in the non-invaded areas of skeletal muscle cells.

Immunohistochemistry. Modified methacarn fixed sections from mouse skeletal muscles with Trichinella spiralis at days 14 and 35 post invasion (d.p.i.) were stained with rabbit polyclonal antibodies against glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase (GNE), α-dystroglycan and ST3 beta-galactoside alpha-2,3-sialyltransferase 6 (ST3Gal6). Paralel sections were subjected to H&E staining to facilitate the histological orientation. Strong expressions of GNE and α-dystroglycan, and moderate expression of ST3Gal6 were observed on days 14 and 35 after invasion, suggesting these proteins as permanent characteristics of the Nurse cell of T. spiralis. The brown colour indicates positive immunohistochemical reaction, hashtag indicates the occupied sarcoplasm, star – non-occupied skeletal muscle cell, arrow – enlarged nucleus, L– larva. H&E, HRP anti-rabbit IgG, DAB. Scale bar 20 μm.

Up-regulation of Gne, Dag1 and St3gal6 in skeletal muscles at day 14 p.i.

T. spiralis infection was verified in all experimental skeletal muscle samples by the amplification of a fragment of the specific Expansion segment V. Genomic DNA of T. spiralis served as a positive control for the ESV fragment. All non-infected skeletal muscle samples were negative (Fig. 2).

Agarose gel analysis of Trichinella spiralis ESV fragment PCR. Polymerase chain reaction was performed on modified methacarn fixed mouse skeletal muscle tissue sections, selected on days 0, 14 and 35 after T. spiralis invasion. Genomic DNA from T. spiralis infectious larvae was used as a positive control sample. Presence of 173 bp fragment of expansion segment V of the T. spiralis genome was detected only in the mouse samples collected on days 14 and 35 after invasion. The photograph is a representative of three randomly selected samples from each experimental group.

The relative expression analysis of the qPCR data showed strong up-regulation of Gne, Dag1 and St3gal6 in skeletal muscles at day 14 p.i. The levels of expression of Gne and St3gal6 at day 35 p.i. were still significantly higher in comparison with the values of day 0 p.i. (Fig. 3).

Discussion

Among all pathological conditions of the skeletal muscle tissue, the establishment of the Nurse cell-parasite complex after invasion by the parasitic nematode Trichinella is unique phenomenon. This complex originates from a portion of the skeletal muscle fiber after invasion by a newborn larva. After penetrating the sarcolemma, the larva induces severe genetic, morphological and functional changes within the occupied syncytium area that transforms into a structure called Nurse cell, capable of supporting the parasitic larva for years (Despommier, 1998). During this process of de-differentiation, at least 53 genes associated with apoptosis, satellite cell activation and proliferation, cell differentiation, cell proliferation and cycle regulation, myogenesis and muscle development change in expression (Wu et al., 2008a). The affected areas lose their contractile properties but the membranes of the newly developing Nurse cells remain adherent within the construction of the contractile fiber.

With their outer position on the oligosaccharide chains, the sialic acids are involved in almost all types of recognition phenomena and adhesion mechanisms, either through masking sites of biological recognition or by representing recognition epitopes (Varki, 2007; Schauer, 2009). They also have a crucial role in the process of gene expression and cell differentiation (Weidemann et al., 2010). In skeletal muscles, the sialic acids are important for the functional maintenance of glycoproteins involved in fiber structure and neuromuscular junctions (McDearmon et al., 2003; Combs & Ervasti, 2005), development and regeneration (Broccolini et al., 2008), muscle excitability (Johnson et al., 2004; Schwetz et al., 2011) and exercise performance (Hanish et al., 2013). They obviously play some role in the process of development of the skeletal muscle cell into a nurse cell, as already reported (Milcheva et al., 2015, 2019, 2020).

The results from this work clearly showed that UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase (GNE), α-dystroglycan and β – galactoside α-2,3-sialyltransferase 6 (ST-3Gal6) take place during the most dynamic period of transformation, and are also a characteristic of the mature Nurse cell.

Expressions of mouse glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase (Gne), dystroglycan 1 (Dag1) and ST3 beta-galactoside alpha-2,3-sialyltransferase 6 (St3gal6) analysed by real time RT-PCR in modified methacarn fixed mouse skeletal muscle tissue sections, selected on days 0, 14 and 35 after T. spiralis invasion. The graphs show the relative quantification of the gene expressions calculated by the ΔΔCt method versus glyceraldehyde phosphate dehydrogenase (Gapdh) as a reference gene from five individual samples in triplicate. The bars show the standard error of mean. The products of amplification were loaded on 2.5% agarose gel versus Perfect 100-1000 bp DNA Ladder.

UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase (GNE) is a cytosolic bifunctional enzyme that catalyzes the first two key steps in sialic acid synthesis (Stäsche et al., 1997). In skeletal muscles the enzyme has very low expression (Horstkorte et al., 1999) and germinal mutation of the GNE gene is responsible for the pathogenesis of hereditary inclusion body myopathy (HIBM) and distal myopathy with rimmed vacuoles (DMRV). These two skeletal muscle disorders share similar clinical features as a consequence of severe hyposialylation of muscle glycoproteins (Nonaka et al., 2005; Broccolini et al., 2009). On the other hand, GNE is up-regulated after muscle injury in both damaged and regenerating myofibers (Nakamura et al., 2010) – a fact that emphasizes the important role of the sialic acids in the maintenance and recovery of muscles.

Dystroglycan is an integral membrane component of the dystrophin-glycoprotein complex (DGC) – a large multicomponent structure that mediates the interactions between the cytoskeleton, membrane, and extracellular matrix. The alpha-subunite of dystroglycan is heavily glycosylated, bearing a specific sialyl-α-2,3-Gal-β-1,4-GlcNAc-β-1,2-Man-α-1-O-Ser/Thr glycan as a major oligosaccharide. Aberrant glycosylation of α-dystroglycan is associated with several inherited muscular disorders, including HIBM and DMRV due to GNE mutation (Sasaki et al., 1998; Lapidos et al., 2004; Cohn 2005). Histological expressions of sialylated glycoproteins in muscles were described in details (Marini et al., 2014). The α-dystroglycan, however, is still the only identified sialylated glycoprotein in skeletal muscles. The loss of dystroglycan itself and depletion of proteins that are involved in the post-translational processing of α-dystroglycan, are not compatible with life (Barresi & Campbell, 2006). Except of our discovery of increased expression of dystroglycan in the Nurse cell, we could not find other information concerning up-regulation of this protein in the available literature. Similarly to Gne however (Nakamura et al., 2010), it is quite possible that Dag1 follows the same pattern of expression under conditions of skeletal muscle injury and repair. Indeed, it was already noticed that the Nurse cell formation and the muscle cell regeneration/repair share some events and mechanisms in parallel (Wu et al., 2008b).

The up-regulation of Gne described in this work was in a very good agreement with our previous findings concerning the increased sialic acid biosynthesis in the Nurse cell (Milcheva et al., 2015, 2019, 2020). Considering the up-regulation of Gne however, we set our attention on the sialyltransferase activity. The finding of increased expression of β-galactoside α-2,3-sialyltransferase 6 (ST3Gal6) was remarkable because this enzyme transfers sialic acid preferably onto Gal-β-1,4-GlcNAc as an acceptor (Takashima, 2008). Therefore, we propose that ST3Gal6 is involved in the sialylation of the major oligosaccharide of α-dystroglycan. Up-regulation of this enzyme has been associated with poor prognosis in patients with multiple myeloma or urinary bladder cancer, and with increased cell proliferation, migration and invasion ability in hepatocellular carcinoma (Glavey et al., 2012; Sun et al., 2017; Dalangood et al., 2020). Considering the skeletal muscle tissue, we could not find information in the available literature whether ST3Gal6 is involved in any pathological or physiological condition. In summary, we showed that the increased local biosynthesis of α-2,3-sialylated glycoconjugates in the Nurse cell of Trichinella spiralis is associated with up-regulation of the gene Gne, encoding the enzyme UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase, which is the key initiator of the sialic acid metabolic pathway. The elevated sialylation is, at least in part, due to an overexpression of α-dystroglycan - the only identified sialylated glycoprotein in skeletal muscles, bearing a sialyl-α-2,3-Gal-β-1,4-GlcNAc-β-1,2-Man-α-1-O-Ser/Thr glycan. These two events were in a correlation with up-regulation of St3gal6 sialyltransferase that transfers sialic acid preferably onto Gal-β-1,4-GlcNAc as an acceptor, and thus it was considered as a suitable candidate for the sialylation of the α-dystroglycan. All these interconnected processes could be either part from a self-defense mechanism of the Nurse cell to remain integrated within the surrounding healthy skeletal muscle tissue, or an attempt for healing and regeneration of the distorted tissue.

Figures et tableaux

The full names of the investigated genes and their primers sequences used in this study.

Gene	Abbreviation	Species	Accession number	Primers sequences (5`-3`)	Product size (bp)
Glyceraldehyde 3-phosphate dehydrogenase	Gapdh	Mus musculus	NM_001289726, transcript variant 1	TCCTCGTCCCGTAGACAAAATG –F AATCTCCACTTTGCCACTGC – R	103
Glucosamine (UDP-N- acetyl) – 2 – epimerase/N- acetylmannosamine kinase	Gne	Mus musculus	NM_015828.3	AATCCTGCAGATGTGTGTGG –F AATGCAGCACAACTCCTTCC – R	119
Dystroglycan 1	Dag1	Mus musculus	NM_001276485.1, transcript variant 5	GTTGGCATTCCAGACGGTAC –F AGTGTAGCCAAGACGGTAAGG – R	136
ST3 beta-galactoside alpha- 2,3-sialyltransferase 6	St3gal6	Mus musculus	NM_018784.2	TCCCAGCTGAAGAAATGAGGAC –F TCAGCTCTGCACAGAAATGG – R	112
Expansion segment V	ESV	Trichinella spiralis	*	GTTCCATGTGAACAGCAGT –F CGAAAACATACGACAACTGC – R	173

Références

Barresi, R., Campbell, K.P. (2006): Dystroglycan: from biosynthesis to pathogenesis of human disease. J Cell Sci, 119(2): 199–207. DOI: 10.1242/jcs.02814 Barresi R. Campbell K.P. 2006 Dystroglycan: from biosynthesis to pathogenesis of human disease J Cell Sci 1192 199 207 10.1242/jcs.0281416410545Ouvrir le DOI Search in Google Scholar

Broccolini, A., Gidaro, T., De Cristofaro, R., Morosetti, R., Gliubizzi, C., Ricci, E., Tonali, P.A., Mirabella, M. (2008): Hyposialylation of neprilysin possibly affects its expression and enzymatic activity in hereditary inclusion-body myopathy muscle. J Neurochem, 105(3): 971–981. DOI: 10.1111/j.1471-4159.2007.05208.x Broccolini, A., Gidaro, T., Morosetti, R., Mirabella, M. (2009): Hereditary inclusion-body myopathy: clues on pathogenesis and possible therapy. Muscle Nerve, 40(3): 340–349. DOI: 10.1002/mus.21385 Broccolini A. Gidaro T. De Cristofaro R. Morosetti R. Gliubizzi C. Ricci E. Tonali P.A. Mirabella M. 2008 Hyposialylation of neprilysin possibly affects its expression and enzymatic activity in hereditary inclusion-body myopathy muscle J Neurochem 1053 971 981 10.1111/j.1471-4159.2007.05208.x Broccolini A., Gidaro, T., Morosetti, R., Mirabella, M. (2009): Hereditary inclusion-body myopathy: clues on pathogenesis and possible therapy. Muscle Nerve 40(3) 340-349 10.1002/mus.21385Ouvrir le DOI Search in Google Scholar

Cohn, R.D. (2005): Dystroglycan: important player in skeletal muscle and beyond. Neuromusc Dis, 15(3): 207–217. DOI: 10.1016/j.nmd.2004.11.005 Cohn R.D. 2005 Dystroglycan: important player in skeletal muscle and beyond Neuromusc Dis 153 207 217 10.1016/j.nmd.2004.11.00515725582Ouvrir le DOI Search in Google Scholar

Combs, A.C., Ervasti, J.M. (2005): Enhanced laminin binding by alpha-dystroglycan after enzymatic deglycosylation. Biochem J, 390(1): 303–309. DOI: 10.1042/BJ20050375 Combs A.C. Ervasti J.M. 2005 Enhanced laminin binding by alpha-dystroglycan after enzymatic deglycosylation Biochem J 3901 303 309 10.1042/BJ20050375118458315865602Ouvrir le DOI Search in Google Scholar

Cox, M.L., Schary, C.L., Luster, C.W., Stewart, Z.S., Korytko, P.J., Khan, K.N.M., Paulauskis, J.D., Dunston, R.W. 2006: Assestment of fixatives, fixation, and tissue processing on morphology and RNA integrity. Exp Mol Pathol, 80(2): 183–191. DOI: 10.1016/j.yexmp.2005.10.002 Cox M.L. Schary C.L. Luster C.W. Stewart Z.S. Korytko P.J. Khan K.N.M. Paulauskis J.D. Dunston R.W. 2006 Assestment of fixatives, fixation, and tissue processing on morphology and RNA integrity Exp Mol Pathol 802 183 191 10.1016/j.yexmp.2005.10.00216332367Ouvrir le DOI Search in Google Scholar

Dalangood, S., Zhu, Zh., Ma, Zh., Li, J., Zeng, Q., Yan, Y., Shen, B., Yan, J., Huang, R. (2020): Identification of glycogene-type and validation of ST3Gal6 as a biomarker predicts clinical outcome and cancer cell invasion in urinary bladder cancer. Theranostics, 10(22): 10078–10091. DOI: 10.7150/thno.48711 Dalangood S. Zhu Zh. Ma Zh. Li J. Zeng Q. Yan Y. Shen B. Yan J. Huang R. 2020 Identification of glycogene-type and validation of ST3Gal6 as a biomarker predicts clinical outcome and cancer cell invasion in urinary bladder cancer Theranostics 1022 10078 10091 10.7150/thno.48711748143032929335Ouvrir le DOI Search in Google Scholar

Despommier, D.D. (1998): How does Trichinella spiralis make itself at home? Parasitol Today, 14(8): 318–23. DOI: 10.1016/s0169-4758(98)01287-3 Despommier D.D. 1998 How does Trichinella spiralis make itself at home? Parasitol Today 148 318 23 10.1016/s0169-4758(98)01287-317040798Ouvrir le DOI Search in Google Scholar

Glavey, S.V., Cunningham, S., Murillo, L.S., Loughrey, C., Wu, P., Cairns, M., Gill, S.K., Kruger, A., Gerlach, J.Q., Kane, M., Morgan, G.J., Joshi, L., O`Dwyer, M.E. (2012): Glycosylation-related gene expression is dysregulated in multiple myeloma and overexpression of the sialyltransferase ST3Gal6 is associated with inferior survival. In Abstracts of Myeloma – Biology and Pathophysiology, Excluding Therapy: Poster II. November 16, 2012. Blood, 120 (21): 2931. DOI: 10.1182/blood.V120.21.2931.2931 Glavey S.V. Cunningham S. Murillo L.S. Loughrey C. Wu P. Cairns M. Gill S.K. Kruger A. Gerlach J.Q. Kane M. Morgan G.J. Joshi L. O`Dwyer M.E. 2012 Glycosylation-related gene expression is dysregulated in multiple myeloma and overexpression of the sialyltransferase ST3Gal6 is associated with inferior survival In Abstracts of Myeloma – Biology and Pathophysiology, Excluding Therapy: Poster II. November 16 2012 Blood 120 21 2931 10.1182/blood.V120.21.2931.2931Ouvrir le DOI Search in Google Scholar

Hanisch, F., Weidemann, W., Grossmann, M., Joshi, P.R., Holzhausen, H.J., Stoltenburg, G., Weis, J., Zierz, S., Horstkorte, R. (2013): Sialylation and muscle performance: Sialic acid is a marker of muscle ageing. PLOS One, 8(12): e80520. DOI: 10.1371/journal.pone.0080520 Hanisch F. Weidemann W. Grossmann M. Joshi P.R. Holzhausen H.J. Stoltenburg G. Weis J. Zierz S. Horstkorte R. 2013 Sialylation and muscle performance: Sialic acid is a marker of muscle ageing PLOS One 812 e80520 10.1371/journal.pone.0080520385965424349002Ouvrir le DOI Search in Google Scholar

Hinderlich, S., Stäsche, R., Zeitler, R., Reutter, W. (1997): A bifunctional enzyme catalyzes the first two steps in N-acetylneuraminic acid biosynthesis of rat liver. Purification and characterization of UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase. J Biol Chem, 272(39): 24313–24318. DOI: 10.1074/jbc.272.39.24313 Hinderlich S. Stäsche R. Zeitler R. Reutter W. 1997 A bifunctional enzyme catalyzes the first two steps in N-acetylneuraminic acid biosynthesis of rat liver Purification and characterization of UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase. J Biol Chem 27239 24313 24318 10.1074/jbc.272.39.243139305887Ouvrir le DOI Search in Google Scholar

Horstkorte, R., Nöhring, S., Wiechens N., Scwarzkopf, M., Danker, K., Reutter, W., Lucka, L. (1999): Tissue expression and amino acid sequence of murine UDP-N-acetylglucosamine-2-epimerase/N-acetylmannosamine kinase. Eur J Biochem, 260(3): 923–927. DOI: 10.1046/j.1432-1327.1999.00253.x Horstkorte R. Nöhring S. Wiechens N. Scwarzkopf M. Danker K. Reutter W. Lucka L. 1999 Tissue expression and amino acid sequence of murine UDP-N-acetylglucosamine-2-epimerase/N-acetylmannosamine kinase Eur J Biochem 2603 923 927 10.1046/j.1432-1327.1999.00253.x10103025Ouvrir le DOI Search in Google Scholar

Johnson, D., Montpetit, M.L., Stocker, P.J., Bennett, E.S. (2004): The sialic acid component of the βsubunit modulates voltage-gat-₁ ed sodium channel function. J Biol Chem, 279(43): 44303–44310. DOI: 10.1074/jbc.M408900200 Johnson D. Montpetit M.L. Stocker P.J. Bennett E.S. 2004 The sialic acid component of the βsubunit modulates voltage-gat-₁ ed sodium channel function J Biol Chem 27943 44303 44310 10.1074/jbc.M40890020015316006Ouvrir le DOI Search in Google Scholar

Lapidos, K.A., Kakar, R., McNally, E.M. (2004): The dystrophin glycoprotein complex. Signalling strength and integrity for the sarcolemma. Circ Res, 94(8): 1023–1031. DOI: 10.1161/01.RES.0000126574.61061.25 Lapidos K.A. Kakar R. McNally E.M. 2004 The dystrophin glycoprotein complex Signalling strength and integrity for the sarcolemma. Circ Res 948 1023 1031 10.1161/01.RES.0000126574.61061.2515117830Ouvrir le DOI Search in Google Scholar

Marini, M., Ambrosini, S., Sarchielli, E., Thyrion, G.D., Bonacini, L., Vannelli, G.B., Sgambati E. (2014): Expression of sialic acids in human adult skeletal muscle tissue. Acta Histochem, 116(5): 926–935. DOI: 10.1016/j.acthis.2014.03.005 Marini M. Ambrosini S. Sarchielli E. Thyrion G.D. Bonacini L. Vannelli G.B. Sgambati E. 2014 Expression of sialic acids in human adult skeletal muscle tissue Acta Histochem 1165 926 935 10.1016/j.acthis.2014.03.00524703356Ouvrir le DOI Search in Google Scholar

McDearmon, E.L., Combs, A. C., Ervasti, J.M. (2003): Core 1 glycans on α-dystroglycan mediate laminin-induced acetylcholine receptor clustering but not laminin binding. J Biol Chem, 278(45): 44868–44873. DOI: 10.1074/jbc.M307026200 McDearmon E.L. Combs A. C. Ervasti J.M. 2003 Core 1 glycans on α-dystroglycan mediate laminin-induced acetylcholine receptor clustering but not laminin binding J Biol Chem 27845 44868 44873 10.1074/jbc.M30702620012952987Ouvrir le DOI Search in Google Scholar

Milcheva, R., Ivanov, D., Iliev, I., Russev, R., Petkova, S., Babál, P. (2015): Increased sialylation as a phenomenon in the accommodation of the parasitic nematode Trichinella spiralis (Owen, 1835) in skeletal muscle fibres. Folia Parasitol, 7(62): 2015.049. DOI: 10 14411/fp.2015.049 Milcheva R. Ivanov D. Iliev I. Russev R. Petkova S. Babál P. 2015 Increased sialylation as a phenomenon in the accommodation of the parasitic nematode Trichinella spiralis (Owen, 1835) in skeletal muscle fibres Folia Parasitol 762 2015 049. DOI: 10 14411/fp.2015.04910.14411/fp.2015.049Search in Google Scholar

Milcheva, R., Janega, P., Celec, P., Petkova, S., Hurniková, Z., Izrael-Vlková B., Todorova, K., Babál, P. (2019): Accumulation of α-2,6-sialoglycoproteins in the muscle sarcoplasm due to Trichinella sp. invasion. Open Life Sci, 14: 470–481. DOI: 10.1515/boil-2019-0053 Milcheva R. Janega P. Celec P. Petkova S. Hurniková Z. Izrael-Vlková B. Todorova K. Babál P. 2019 Accumulation of α-2,6-sialoglycoproteins in the muscle sarcoplasm due to Trichinella sp. invasion Open Life Sci 14 470 481 10.1515/boil-2019-0053Ouvrir le DOI Search in Google Scholar

Milcheva, R.S., Janega, P., Petkova, S.L., Todorova, K.S., Ivanov, D.G., Babál, P. (2020): Absence of ST3Gal2 and ST3Gal4 sialyltransferase expressions in the Nurse cell of Trichinella spiralis Bul J Vet Med, Online First. DOI: 10.15547/bjvm.2020-0006 Milcheva R.S. Janega P. Petkova S.L. Todorova K.S. Ivanov D.G. Babál P. 2020 Absence of ST3Gal2 and ST3Gal4 sialyltransferase expressions in the Nurse cell of Trichinella spiralis i>Bul J Vet Med, Online First 10.15547/bjvm.2020-0006Ouvrir le DOI Search in Google Scholar

Nakamura, K., Tsukimoto, Y., Hijiya, N., Niguchi, Y., Yano, S., Yokoyama, S., Kumamoto, T., Moriyama, M. (2010): Induction of GNE in myofibers after muscle injury. Pathobiology, 77(4): 191–199. DOI: 10.1159/000292652 Nakamura K. Tsukimoto Y. Hijiya N. Niguchi Y. Yano S. Yokoyama S. Kumamoto T. Moriyama M. 2010 Induction of GNE in myofibers after muscle injury Pathobiology 774 191 199 10.1159/00029265220616614Ouvrir le DOI Search in Google Scholar

Nonaka, I., Noguchi, S., Nishino I. (2005): Distal myopathy with rimmed vacuoles and hereditary inclusion body myopathy. Curr Neurol Neurosci Rep, 5(1): 61–65. DOI: 10.1007/s11910-005-0025-0 Nonaka I. Noguchi S. Nishino I. 2005 Distal myopathy with rimmed vacuoles and hereditary inclusion body myopathy Curr Neurol Neurosci Rep 51 61 65 10.1007/s11910-005-0025-015676110Ouvrir le DOI Search in Google Scholar

Petrof, B.J., Shrager, J.B., Stedman, H.H., Kelly, A.M., Sweeney, H.L. (1993): Dystrophin protects the sarcolemma from stresses developed during muscle contraction. Proc Natl Acad Sci USA, 90(8): 3710–3714. DOI: 10.1073/pnas.90.8.3710 Petrof B.J. Shrager J.B. Stedman H.H. Kelly A.M. Sweeney H.L. 1993 Dystrophin protects the sarcolemma from stresses developed during muscle contraction Proc Natl Acad Sci USA 908 3710 3714 10.1073/pnas.90.8.3710463718475120Ouvrir le DOI Search in Google Scholar

Sasaki, T., Yamada, H., Matsumura, K., Shimizu, T., Kobata, A., Endo, T. (1998): Detection of O-mannosyl glycans in rabbit skeletal muscle α-dystroglycan. Biochim Biophys Acta, 1425(3): 599–606. DOI: 10.1016/s0304-4165(98)00114-7 Sasaki T. Yamada H. Matsumura K. Shimizu T. Kobata A. Endo T. 1998 Detection of O-mannosyl glycans in rabbit skeletal muscle α-dystroglycan Biochim Biophys Acta 14253 599 606 10.1016/s0304-4165(98)00114-79838223Ouvrir le DOI Search in Google Scholar

Schauer, R. (2009): Sialic acids as regulators of molecular and cellular interactions. Curr Opin Struct Biol, 19(5): 507–514. DOI: 10.1016/j.sbi.2009.06.003 Schauer R. 2009 Sialic acids as regulators of molecular and cellular interactions Curr Opin Struct Biol 195 507 514 10.1016/j.sbi.2009.06.003712737619699080Ouvrir le DOI Search in Google Scholar

Schwetz, T.A., Norring, N.A., Ednie, A.R., Bennett, E.S. (2011): Sialic Acids Attached to O-Glycans Modulate Voltage-gated Potassium Channel Gating. J Biol Chem, 286(6): 4123–4132. DOI: 10.1074/jbc.M110.171322 Schwetz T.A. Norring N.A. Ednie A.R. Bennett E.S. 2011 Sialic Acids Attached to O-Glycans Modulate Voltage-gated Potassium Channel Gating J Biol Chem 2866 4123 4132 10.1074/jbc.M110.171322303932121115483Ouvrir le DOI Search in Google Scholar

Stäsche, R., Hinderlich, S., Weise, C., Effertz, K., Lucka, L., Moormann, R., Reutter, W. (1997): A bifunctional enzyme catalyzes the first two steps in N-acetylneuraminic acid biosynthesis of rat liver. Molecular cloning and functional expression of UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase. J Biol Chem, 272(39): 24319–24324. DOI: 10.1074/jbc.272.39.24319 Stäsche R. Hinderlich S. Weise C. Effertz K. Lucka L. Moormann R. Reutter W. 1997 A bifunctional enzyme catalyzes the first two steps in N-acetylneuraminic acid biosynthesis of rat liver Molecular cloning and functional expression of UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase. J Biol Chem 27239 24319 24324 10.1074/jbc.272.39.243199305888Ouvrir le DOI Search in Google Scholar

Sun, M., Zhao, X., Liang, L., Pan, X., Lv, X., Zhao Y. (2017): Sialyltransferase ST3Gal6 mediates the effect of microRNA-26a on cell growth, migration, and invasion in hepatocellular carcinoma through the protein kinase B/mammalian target of rapamycin pathway. Cancer Sci, 108 (2): 267–276. DOI: 10.1111/cas.13128 Sun M. Zhao X. Liang L. Pan X. Lv X. Zhao Y. 2017 Sialyltransferase ST3Gal6 mediates the effect of microRNA-26a on cell growth, migration, and invasion in hepatocellular carcinoma through the protein kinase B/mammalian target of rapamycin pathway Cancer Sci 108 2 267 276 10.1111/cas.13128532915327906498Ouvrir le DOI Search in Google Scholar

Takashima, S. (2008): Characterization of mouse sialyltransferase genes: their evolution and diversity. Biosci Biotechnol Biochem, 72(5): 1155–1167. DOI: 10.1271/bbb.80025 Takashima S. 2008 Characterization of mouse sialyltransferase genes: their evolution and diversity Biosci Biotechnol Biochem 725 1155 1167 10.1271/bbb.8002518460788Ouvrir le DOI Search in Google Scholar

Varki, A. (2007): Glycan-based interactions involving vertebrate sialic-acid-recognizing proteins. Nature, 446: 1023–1029. DOI: 10.1038/nature05816 Varki A. 2007 Glycan-based interactions involving vertebrate sialic-acid-recognizing proteins Nature 446 1023 1029 10.1038/nature0581617460663Ouvrir le DOI Search in Google Scholar

Varki,, A. (1997): Sialic acids as ligands in recognition phenomena. FASEB J, 11(4): 248–255. DOI: 10.1096/fasebj.11.4.9068613 Weidemann, W., Klukas, C., Klein, A., Simm, A., Schreiber, F., Horstkorte, R. (2010): Lessons from GNE – deficient embryonic stem cells: sialic acid biosynthesis is involved in proliferation and gene expression. Glycobiology, 20(1): 107–117. DOI: 10.1093/glycob/cwp153 Varki A. 1997 Sialic acids as ligands in recognition phenomena FASEB J 114 248 255 10.1096/fasebj.11.4.9068613 Weidemann, W., Klukas, C., Klein, A., Simm, A., Schreiber, F., Horstkorte, R. (2010): Lessons from GNE – deficient embryonic stem cells: sialic acid biosynthesis is involved in proliferation and gene expression. Glycobiology 20(1) 107-117 10.1093/glycob/cwp153Ouvrir le DOI Search in Google Scholar

Wu, Z., Nagano, I., Takahashi, Y. (2008a): Candidate genes responsible for common and different pathology of infected muscle tissues between Trichinella spiralis and T. pseudospiralis infection. Parasitol Int, 57(3): 368–378. DOI: 10.1016/j.parint.2008.03.005 Wu, Z., Sofronic-Milosavljevic, L., Nagano, I., Takahashi, Y. (2008b): Trichinella spiralis: nurse cell formation with emphasis on analogy to muscle cell repair. Parasit Vectors, 1(1): 27. DOI: 10.1186/1756-3305-1-27 Wu Z. Nagano I. Takahashi Y. 2008a Candidate genes responsible for common and different pathology of infected muscle tissues between Trichinella spiralis and T pseudospiralis infection. Parasitol Int 573 368 378 10.1016/j.parint.2008.03.005 Wu, Z., Sofronic-Milosavljevic, L., Nagano, I., Takahashi, Y. (2008b): Trichinella spiralis: nurse cell formation with emphasis on analogy to muscle cell repair. Parasit Vectors, 1(1): 27. 10.1186/1756-3305-1-2718501667Ouvrir le DOI Search in Google Scholar

Ye, J., Coulouris, G., Zaretskaya, I., Cutcutache, I., Rozen, S., Madden, T. (2012): Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics, 13: 134. DOI: 10.1186/1471-2105-13-134 Ye J. Coulouris G. Zaretskaya I. Cutcutache I. Rozen S. Madden T. 2012 Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction BMC Bioinformatics 13 134 10.1186/1471-2105-13-134341270222708584Ouvrir le DOI Search in Google Scholar

Zarlenga, D.S., Chute, M.B., Martin, A., Kapel, C.M.O. (2001): A single, multiplex PCR for differentiating all species of Trichinella Parasite, 8(2): S24 – S26. DOI: 10.1051/parasite/200108s2024 Zarlenga D.S. Chute M.B. Martin A. Kapel C.M.O. 2001 A single, multiplex PCR for differentiating all species of Trichinella Parasite 82 S24 S26 10.1051/parasite/200108s202411484367Ouvrir le DOI Search in Google Scholar

Zhang, J.D., Ruschhaupt, M., Biczok, R. (2014): ddCt method for qRT-PCR data analysis. Retrieved October 2021 from http://bioconductor.jp/packages/2.14/bioc/vignettes/ddCt/inst/doc/rtPCR.pdf Zhang J.D. Ruschhaupt M. Biczok R. 2014 ddCt method for qRT-PCR data analysis Retrieved October 2021 from http://bioconductor.jp/packages/2.14/bioc/vignettes/ddCt/inst/doc/rtPCR.pdfSearch in Google Scholar

Helminthologia

The synthesis of UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase (GNE), α-dystroglycan, and β-galactoside α-2,3-sialyltransferase 6 (ST3Gal6) by skeletal muscle cell as a response to infection with Trichinella spiralis

R. Milcheva,
R. Milcheva,
K. Todorova,
K. Todorova,
A. Georgieva et
A. Georgieva et
S. Petkova
S. Petkova

Publié en ligne: 17 Dec 2022

Volume & Edition: Volume 59 (2022) - Edition 3 (September 2022)

Pages: 217 - 225

Reçu: 22 Mar 2022

Accepté: 17 Aug 2022

Détails du journal et du numéro

Helminthologia

Aperçu PDF

Article

Fig. 1

Fig. 2

Fig. 3

Figures et tableaux

Fig. 1

Fig. 2

Fig. 3

The full names of the investigated genes and their primers sequences used in this study.

Références

Articles récents

Planifiez votre conférence à distance avec Sciendo

Helminthologia

The synthesis of UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase (GNE), α-dystroglycan, and β-galactoside α-2,3-sialyltransferase 6 (ST3Gal6) by skeletal muscle cell as a response to infection with Trichinella spiralis

R. Milcheva,R. Milcheva,K. Todorova,K. Todorova,A. Georgieva etA. Georgieva etS. PetkovaS. Petkova

Publié en ligne: 17 Dec 2022

Volume & Edition: Volume 59 (2022) - Edition 3 (September 2022)

Pages: 217 - 225

Reçu: 22 Mar 2022

Accepté: 17 Aug 2022

Détails du journal et du numéro

Helminthologia

Aperçu PDF

Article

Fig. 1

Fig. 2

Fig. 3

Figures et tableaux

Fig. 1

Fig. 2

Fig. 3

The full names of the investigated genes and their primers sequences used in this study.

Références

Articles récents

Planifiez votre conférence à distance avec Sciendo

R. Milcheva,
R. Milcheva,
K. Todorova,
K. Todorova,
A. Georgieva et
A. Georgieva et
S. Petkova
S. Petkova