Screening of Toxin Genes in Methicillin-Resistant Staphylococcus aureus Clinical Isolates from a Hospital Setting in a Tertiary Hospital in Northern Cyprus
Methicillin-resistant Staphylococcus aureus (MRSA) represents one of the most concerning pathogens worldwide, responsible for community-acquired and hospital-acquired infections (Kourtis et al. 2019; Turner et al. 2019). According to the Centers for Disease Prevention and Control (CDC), antibiotic-resistant S. aureus causes over 2 million cases of disease and 23,000 deaths each year in the United States alone (Okwu et al. 2019). In addition to their intrinsic resistance to β-lactam antibiotics, hospital-associated MRSA strains often exhibit a variable yet alarming level of multi-drug resistance which narrows treatment alternatives to the limited remaining efficient drugs (Bispo et al. 2020; Jernigan et al. 2020).
The molecular characteristics of S. aureus can change over time, and the population structure varies regionally, according to epidemiological studies of S. aureus (Barcudi et al. 2020; Junnila et al. 2020; Lu et al. 2021). Over 94% of S. aureus strains are reported to be resistant to penicillin and its derivatives due to the release of the penicillinase enzyme, beta-lactamase, which inhibits penicillin by hydrolyzing the beta-lactam ring (Algammal et al. 2020). MRSA is characterized predominantly by the presence of either the mecA gene or its homologs mecB, mecC and mecD, that are located on the staphylococcal chromosomal cassette mec (SCCmec type I–XIV) and code for the penicillin-binding protein 2a (PBP2-a) that has a reduced affinity for beta-lactam antibiotics (Urushibara et al. 2020; Uehara 2022).
From a clinical perspective, the increasing use of molecular and other bioinformatics tools has facilitated the mapping of the S. aureus virulome and clarified its epidemiological and clinical significance. S. aureus generates an array of virulence factors that allow the bacteria to survive extreme conditions within the human host and damages biological membranes, resulting in cell death (Shettigar and Murali 2020; Nisar et al. 2021). S. aureus maintains fine control of the expression of virulence factors which include hemolysins, leukocidins, proteases, exfoliative toxins, enterotoxins, and immunemodulatory factors.
The development of clinical management and infection control policies presents a significant challenge as there is still insufficient data on the infection transmission rate and clone characteristics. It is, therefore, of paramount importance to investigate the epidemiology and the molecular profile of S. aureus. The current study aims to characterize toxin-associated virulence determinants in a wide range of clinical isolates in a previously understudied region of Northern Cyprus.
Experimental
Materials and Methods
Clinical isolates. In total, 91 clinical non-repetitive S. aureus strains isolated between January 2012 and November 2020, identified initially to be MRSA by BD Phoenix™ 100 automated identification and antibiotic susceptibility system, were collected and investigated in this study. Isolates were cultured from wound/ abscess, blood, bronchoalveolar lavage, nasal swab, tracheal aspiration, and sputum samples from different departments at the Near East University Hospital in Northern Cyprus.
Identification and phenotypic detection of methicillin resistance. All isolates were cultured on sheep blood agar. Agar plates were incubated at 35°C for 24–48 h in 5% CO2. The isolates were subsequently confirmed as S. aureus based on colony morphology and ability to coagulate human plasma. Methicillin resistance was assessed using the disc diffusion method with cefoxitin (30 μg) (Bioanalyse, Turkey) on Mueller-Hinton agar (Difco, Becton Dickinson, USA) plates. Antibiotic susceptibility was assessed with the European Committee on Antimicrobial Susceptibility Testing guidelines (EUCAST 2020).
DNA extraction. Rapid extraction of genomic DNA was performed with the boiling method described by Barbosa et al. (2016). Briefly, a few colonies cultured on blood agar were suspended in nuclease-free water in a microcentrifuge tube. The cell suspension was then incubated at 100°C for 15 min and centrifuged at 13,000 rpm for 5 min to sediment the debris. After centrifugation, the supernatant was collected and utilized as a DNA template in polymerase chain reaction (PCR) reactions.
Molecular identification of the isolates. The preliminary identification procedures were followed by the PCR analysis using S. aureus species-specific thermonuclease (nuc) primers, as previously shown (Amin et al. 2020). The nuc gene was amplified in a 25-μl reaction which contained: PCR Master Mix 2× (Thermo Fisher Scientific, USA), Taq DNA polymerase (0.05 U/μl), 0.4 mM of each dNTP, 4 mM MgCl2, 4 μl of template DNA, and 10 pmol of forward and reverse primer nuc-F 5’-GCGATTGATGGTGATACGGTT-3’, nuc-R 5’-AGCCAAGCCTTGACGAACTAAAGC-3’. DNA amplification was performed involving denaturation at 94°C for 10 min, 30 cycles at 94°C for 30 s, 55°C for 30 s, and 72°C for 1 min, and a final elongation step at 72°C for 5 min. The PCR detection of mecA confirmed the methicillin resistance. Amplification was achieved as described before (Rahman et al. 2018) except for a denaturation step at 94°C for 10 min. The strain of S. aureus SCCmec type IV (mecA+, pvl–, nuc+) was used as a positive control. Distilled water was used as a negative control. Verification of PCR products was obtained using 1.5% agarose gel. Ethidium bromide was used for staining the gels, and amplicons were observed with MiniBIS Pro Gel Documentation Platform (DNR, Israel).
Screening for virulence genes in MRSA. The occurrence of virulence-associated genes was investigated by PCR detection of hla, eta, etb, etd and tst in all confirmed MRSA isolates. Single PCR reactions were performed as described above. PCR amplification for each primer set was performed using Bio-Rad MyCycler™ Thermal Cycler (Bio-Rad Laboratories, Israel) according to the cycling parameters summarized in Table I. PCR products were analyzed with gel electrophoresis through 2% agarose gel and visualized using a transilluminator. The positive controls included the genomic DNA from isolates in which the presence of the genes mentioned above was formerly found in the genome.
Statistical analysis. Statistical data analysis was performed using SPSS Version 25.0 (SPSS, Inc., USA). Comparison of variables was achieved using independent t-tests and Chi-square test of association. A p-Value of ≤ 0.05 was considered statistically significant.
Ethics approval. The Institutional Review Board approved this study at Near East University with a waiver of patient consent (YDU/2020/80-1115, YDU/ 2021/90-1331).
Results
Patients features. A total of 91 non-duplicate samples were initially screened. Of these, 80.85% (76/91) strains were identified as MRSA using phenotypic and genotypic methods, among which 57.9% (44/76) were recovered from male patients. The distribution of isolates according to patient admission status indicated that 75% (57/76) of the isolates were obtained from inpatients. Despite the predominance of the male gender, no statistically significant difference was observed in gender distribution across inpatient and outpatient groups (p = 0.107) (Table II). Patient age at admission ranged from 1 to 99 years (mean: 60.16, median: 63.00, standard deviation: 22.21), and the majority of patients with MRSA infection were over the age of 45 (p < 0.005) (Table II) with the inpatients group being significantly older (p < 0.001). No significant association was observed between patient age and gender (p = 0.901).
Distribution of MRSA isolates according to age, gender, and admission status.
Demographic data
n (%)
p-value
Age groups
Under 15
2 (2.6)
< 0.005
15–44
16 (21.1)
45–64
22 (28.9)
65 and above
36 (47.4)
Gender
Male
44 (57.9)
0.107
Female
32 (42.1)
Admissions
Inpatients
57 (75)
< 0.001
Outpatients
19 (25)
Majority of the isolates obtained in this study originated from patients admitted to cardiology (n = 14; 18.4%), pulmonary infections (n = 10; 13.2%), infectious diseases (n = 10; 13.2%), anesthesiology (n = 7; 9.2%), orthopedics and traumatology (n = 6; 7.9%), cardiovascular surgery (n = 5; 6.6%), general surgery (n = 5; 6.6%), neurosurgery (n = 4; 5.3%), dermatology (n = 4; 5.3%), brain surgery (n = 2; 2.6%), gastroenterology (n = 2; 2.6%), intensive care unit (n = 2; 2.6%), and the remaining departments; dialysis, neurology, plastic surgery, urology, and pediatrics (n = 5; 6.6%). The distribution of isolates by the hospital department is shown in Table III.
Distribution of MRSA isolates according to the hospital department.
Department
n (%)
Cardiology
14 (18.4)
Pulmonary infections
10 (13.2)
Infectious diseases
10 (13.2)
Anesthesiology
7 (9.2)
Orthopedics and traumatology
6 (7.9)
Cardiovascular surgery
5 (6.6)
General surgery
5 (6.6)
Dermatology
4 (5.3)
Neurosurgery
4 (5.3)
Brain surgery
2 (2.6)
Gastroenterology
2 (2.6)
Intensive care unit
2 (2.6)
Dialysis
1 (1.3)
Neurology
1 (1.3)
Pediatrics
1 (1.3)
Plastic surgery
1 (1.3)
Urology
1 (1.3)
Total
76 (100)
Majority of the samples from which MRSA were cultured were isolated from abscess-wound (n = 19; 25.0%), blood (n = 17; 22.4%), nasal swabs (n = 13; 17.1%), and tracheal aspirates (n = 13; 17.1%). The distribution of the isolates according to the sample type is given in Table IV.
Distribution of MRSA isolates according to the sample source.
Sample source
n (%)
Abscess-wound
19 (25.0)
Blood
17 (22.4)
Nasal swab
13 (17.1)
Tracheal aspirate
13 (17.1)
Sputum
5 (6.6)
Urine
4 (5.3)
Catheter tip
3 (3.9)
Bronchioalveolar lavage
1 (1.3)
Urethral swab
1 (1.3)
Total
76 (100)
Confirmation of MRSA isolates. Seventy-six isolates that were found to be non-susceptible to cefoxitin in the disc diffusion assay were verified to be MRSA with the amplification of the mecA gene via single-target PCR. The presence of the mecA gene is demonstrated in Fig. 1.
Fig. 1
Molecular detection of the nuc, mecA, exfA, exfB, tst and hla genes by single target PCR. PC – positive control, NC – negative control, M – 100 bp DNA ladder (Hibrigen) for mecA (533 bp) and tst (326 bp), 50 bp DNA ladder (Hibrigen) for nuc (270 bp), exfA (93 bp), exfB 226 bp) and hla (209 bp), bp – base pairs
Detection of virulence determinants. Among the investigated virulence genes, the α-toxin encoding gene (hla) was found in 97.3% (n = 74/76) of the isolates and it was the most frequently virulence gene detected. Among the MRSA isolates, the frequencies of exfoliative toxin A, B, D and TSST-1 encoding genes (eta, etb, etd, tst) were 2.63% (n = 2/76), 1.3%, (n = 1/76), 0%, and 2.63% (n = 2/76), respectively.
Discussion
MRSA represents a significant public health threat, particularly in developing countries owing to its ability to lead to life-threatening infections (Li et al. 2021; Pannewick et al. 2021). Regarding MRSA-induced infections and their burden in healthcare, studies focusing on regional epidemiology have demonstrated significant differences among regions (Gagliotti et al. 2021; Tsuzuki et al. 2021). For the first time, our present study provides insights into multiple virulence characteristics of S. aureus from clinical specimens in Northern Cyprus.
In the current study, at a trend analysis level, although the gender of the patients had no statistical association with the detection of MRSA, the isolation rate was markedly higher in males. MRSA infections occur less frequently in patients below 45 years of age. Both age and gender-related trends observed in this study were similar to those previously investigated by others (Pomorska-Wesołowska et al. 2017; Thorlacius-Ussing et al. 2019). The isolation frequency of MRSA was highest in wounds and abscesses (25%; n = 19/76) and blood samples (22%; n = 17/76). These findings reinforce the association of skin and soft tissue infections (SSTIs) as a predisposing factor to S. aureus bacteremia (Jorgensen et al. 2019; Horino and Hori 2020).
The effects of S. aureus virulome on the progression of infections have been broadly investigated (Lebughe et al. 2017; Park et al. 2019). While virulence genes can play an important role in the pathogenicity of S. aureus, the circulation of these genes may vary among strains. Therefore, defining the distribution of virulence-associated genes is invaluable for the epidemiological control of S. aureus. The hla gene was detected in 97% of MRSA strains and had the highest frequency of all genes among the virulence factors investigated. This finding is comparable to another study in China in which authors reported that 98.7% (n = 224/227) of the S. aureus isolates were hla-positive (Li et al. 2019). In a separate investigation conducted in Iraq in 2020, S. aureus strains isolated from Syrian and Iraqi refugees were screened, and the hla gene was found in 93.4% (n = 117/125) of the Iraqi community. In contrast, the frequency of hla positivity was 71.4% (n = 89/125) in the Syrian refugee group (Rasheed and Hussein 2020). Alpha-hemolysin is by far the most well studied among the S. aureus cytotoxins, as it is produced by many strains and is toxic to a broad spectrum of mammalian cells.
Exfoliative toxins secreted by S. aureus are essential virulence factors of the bacterium. In our study eta was detected in 3% (n = 2) and etb in 1.5% (n = 1) of the isolates, whereas etd was not detected among the isolates tested. Our study results differed from those obtained by Mohseni et al. in 2018, in which a high frequency of eta (76.7%), etb (16.7%), and etd (54%) in S. aureus clinical isolates was observed. These findings contrast with a previous study in Korea on staphylococcal scalded skin syndrome patient-derived strains, which reported 53.8% of MRSA isolates to be etb-positive (Choi et al. 2021). According to the literature, eta is more common in Europe, Africa, and North America, contributing to over 80% of exfoliative toxin-producing strains, whereas etb is more common in Japan (Mariutti et al. 2017).
Toxic shock syndrome (TSS) manifests as either non-menstrual or menstrual-associated infection. However, cases of menstrual TSS are rarely seen (0.03–0.5/ 100.000), although the strains producing the toxin are often reported (Tong et al. 2015; Berger et al. 2019). It is suggests that the production of the toxin is under tight control (Tuffs et al. 2019). Only 3% (n = 2) of the isolates investigated in this study harbored the tst gene. In other studies, the prevalence of the toxin among the strains was found to be between 14% and 36.8% (Papadimitriou-Olivgeris et al. 2017; Shahini Shams-Abadi et al. 2018; Zhao et al. 2019; Abbasi Montazeri et al. 2021).
In this study, we gained insights into the prevalence of toxin genes among S. aureus clinical isolates. We also identified that the elderly and inpatient population were at high risk of developing an MRSA infection. These findings are invaluable for the genetic characterization of bacterial isolates circulating in Northern Cyprus and call our attention to the need for regular surveillance of MRSA epidemiology. In-depth studies covering the clonal diversity of MRSA strains and the correlation of antimicrobial resistance and toxin gene profiles with specific clones have highlighted these features as variables driving the complex epidemiology of this pathogen (Peterson et al. 2019; Maalej et al. 2019). The recent development of rapid diagnostic technologies contributes to the fast and reliable identification of infectious pathogens. For example, integrated sensing platforms using microfluidics technology and mass spectrometry techniques such as MALDI-TOF have significantly increased the rate of detection of MRSA in clinical samples (Schulz et al. 2020; Zhou et al. 2021). Concurrently, novel therapeutic approaches such as antivirulence drugs and phage therapy are being developed and hold promise for tackling antimicrobial resistance (He et al. 2021; Chang et al. 2022; Naorem et al. 2022).
Conclusion
The data presented indicate that while most strains carry the alpha-toxin gene, the frequency of tst, eta, etb, and etd genes were considerably low in the strains circulating at the main hospital in this region. Our results provide new epidemiological data of S. aureus strains in this region.
Limitations
This work represents a preliminary study with a limited sample size from a single center; therefore the data is not representative of isolates in all hospitals across Cyprus. Additional analyses with a higher number of isolates are required to identify the overall frequency of virulence determinants. Another limitation of the study was the absence of measurements of expression levels of the virulence factors at gene and protein levels.
Molecular detection of the nuc, mecA, exfA, exfB, tst and hla genes by single target PCR. PC – positive control, NC – negative control, M – 100 bp DNA ladder (Hibrigen) for mecA (533 bp) and tst (326 bp), 50 bp DNA ladder (Hibrigen) for nuc (270 bp), exfA (93 bp), exfB 226 bp) and hla (209 bp), bp – base pairs
Distribution of MRSA isolates according to the sample source.
Sample source
n (%)
Abscess-wound
19 (25.0)
Blood
17 (22.4)
Nasal swab
13 (17.1)
Tracheal aspirate
13 (17.1)
Sputum
5 (6.6)
Urine
4 (5.3)
Catheter tip
3 (3.9)
Bronchioalveolar lavage
1 (1.3)
Urethral swab
1 (1.3)
Total
76 (100)
Distribution of MRSA isolates according to age, gender, and admission status.
Demographic data
n (%)
p-value
Age groups
Under 15
2 (2.6)
< 0.005
15–44
16 (21.1)
45–64
22 (28.9)
65 and above
36 (47.4)
Gender
Male
44 (57.9)
0.107
Female
32 (42.1)
Admissions
Inpatients
57 (75)
< 0.001
Outpatients
19 (25)
Oligonucleotides used in this study.
Target
Sequence (from 5’ to 3’)
Product size (bp)
Annealing temp. (°C)
Reference
mecA
Forward
AAAATCGATGGTAAAGGTTGGC
533
55
Kot et al. 2020
Reverse
AGTTCTGCAGTACCGGATTTGC
nuc
Forward
GCGATTGATGGTGATACGGTT
279
55
Amin et al. 2020
Reverse
AGCCAAGCCTTGACGAACTAAAGC
hla
Forward
CTGATTACTATCCAAGAAATTCGATTG
209
57
Rasheed and Hussein 2020
Reverse
CTTTCCAGCCTACTTTTTTATCAGT
eta
Forward
GCAGGTGTTGATTTAGCATT
93
58
Rasheed and Hussein 2020
Reverse
AGATGTCCCTATTTTTGCTG
etb
Forward
ACAAGCAAAAGAATACAGCG
Reverse
GTTTTTGGCTGCTTCTCTTG
226
50
Rasheed and Hussein 2020
etd
Forward
AACTATCATGTATCAAGG
376
47
Liu et al. 2018
Reverse
CAGAATTTCCCGACTCAG
tst
Forward
ACCCCTGTTCCCTTATCATC
Reverse
TTTTCAGTATTTGTAACGCC
326
57
Rasheed and Hussein 2020
Distribution of MRSA isolates according to the hospital department.
Abbasi Montazeri E, Khosravi AD, Khazaei S, Sabbagh A. Prevalence of methicillin resistance and superantigenic toxins in Staphylococcus aureus strains isolated from patients with cancer. BMC Microbiol. 2021 Dec;21(1):262. https://doi.org/10.1186/s12866-021-02319-7AbbasiMontazeri EKhosraviADKhazaeiSSabbaghAPrevalence of methicillin resistance and superantigenic toxins in Staphylococcus aureus strains isolated from patients with cancerBMC Microbiol2021Dec211262https://doi.org/10.1186/s12866-021-02319-710.1186/s12866-021-02319-7848260134587897Search in Google Scholar
Algammal AM, Hetta HF, Elkelish A, Alkhalifah DHH, Hozzein WN, Batiha GES, El Nahhas N, Mabrok MA. Methicillin-resistant Staphylococcus aureus (MRSA): One health perspective approach to the bacterium epidemiology, virulence factors, antibiotic-resistance, and zoonotic impact. Infect Drug Resist. 2020 Sep; 13:3255–3265. https://doi.org/10.2147/IDR.S272733AlgammalAMHettaHFElkelishAAlkhalifahDHHHozzeinWNBatihaGESElNahhas NMabrokMAMethicillin-resistant Staphylococcus aureus (MRSA): One health perspective approach to the bacterium epidemiology, virulence factors, antibiotic-resistance, and zoonotic impactInfect Drug Resist2020Sep1332553265https://doi.org/10.2147/IDR.S27273310.2147/IDR.S272733751982933061472Search in Google Scholar
Amin DHM, Guler E, Baddal B. Prevalence of Panton-Valentine leukocidin in methicillin-resistant Staphylococcus aureus clinical isolates at a university hospital in Northern Cyprus: A pilot study. BMC Res Notes. 2020 Oct 20;13(1):490. https://doi.org/10.1186/s13104-020-05339-0AminDHMGulerEBaddalBPrevalence of Panton-Valentine leukocidin in methicillin-resistant Staphylococcus aureus clinical isolates at a university hospital in Northern Cyprus: A pilot studyBMC Res Notes2020Oct 20131490https://doi.org/10.1186/s13104-020-05339-010.1186/s13104-020-05339-0757672133081819Search in Google Scholar
Barbosa C, Nogueira S, Gadanho M, Chaves S. Chapter 7 – DNA extraction: finding the most suitable method. In: Cook N, D’Agostino M, Thompson KC, editors. Molecular microbial diagnostic methods. San Diego (USA): Academic Press; 2016. p. 135–154. https://doi.org/10.1016/B978-0-12-416999-9.00007-1BarbosaCNogueiraSGadanhoMChavesSChapter 7 – DNA extraction: finding the most suitable method. In: Cook N, D’Agostino M, Thompson KC, editors. Molecular microbial diagnostic methodsSan Diego (USA)Academic Press;2016p135154https://doi.org/10.1016/B978-0-12-416999-9.00007-110.1016/B978-0-12-416999-9.00007-1Search in Google Scholar
Barcudi D, Sosa EJ, Lamberghini R, Garnero A, Tosoroni D, Decca L, Gonzalez L, Kuyuk MA, Lopez T, Herrero I, et al.; Study Group of S. aureus in Córdoba, Argentina. MRSA dynamic circulation between the community and the hospital setting: new insights from a cohort study. J Infect. 2020 Jan;80(1):24–37. https://doi.org/10.1016/j.jinf.2019.10.001BarcudiDSosaEJLamberghiniRGarneroATosoroniDDeccaLGonzalezLKuyukMALopezTHerreroIet alStudy Group of S. aureus in Córdoba, Argentina. MRSA dynamic circulation between the community and the hospital setting: new insights from a cohort studyJ Infect2020Jan8012437https://doi.org/10.1016/j.jinf.2019.10.00110.1016/j.jinf.2019.10.00131606351Search in Google Scholar
Berger S, Kunerl A, Wasmuth S, Tierno P, Wagner K, Brügger J. Menstrual toxic shock syndrome: Case report and systematic review of the literature. Lancet Infect Dis. 2019 Sep;19(9):e313–e321. https://doi.org/10.1016/S1473-3099(19)30041-6BergerSKunerlAWasmuthSTiernoPWagnerKBrüggerJMenstrual toxic shock syndrome: Case report and systematic review of the literatureLancet Infect Dis2019Sep199e313e321https://doi.org/10.1016/S1473-3099(19)30041-610.1016/S1473-3099(19)30041-631151811Search in Google Scholar
Bispo PJM, Ung L, Chodosh J, Gilmore MS. Hospital-associated multidrug-resistant MRSA lineages are trophic to the ocular surface and cause severe microbial keratitis. Front Public Health. 2020 Jun 3;8:204. https://doi.org/10.3389/fpubh.2020.00204BispoPJMUngLChodoshJGilmoreMSHospital-associated multidrug-resistant MRSA lineages are trophic to the ocular surface and cause severe microbial keratitisFront Public Health2020Jun 38204https://doi.org/10.3389/fpubh.2020.0020410.3389/fpubh.2020.00204728349432582610Search in Google Scholar
Chang RYK, Nang SC, Chan HK, Li J. Novel antimicrobial agents for combating antibiotic-resistant bacteria. Adv Drug Deliv Rev. 2022 Aug;187:114378. https://doi.org/10.1016/j.addr.2022.114378ChangRYKNangSCChanHKLiJNovel antimicrobial agents for combating antibiotic-resistant bacteriaAdv Drug Deliv Rev2022Aug187114378https://doi.org/10.1016/j.addr.2022.11437810.1016/j.addr.2022.11437835671882Search in Google Scholar
Choi JH, Lee H, Choi EH. Antimicrobial resistance and molecular analysis of Staphylococcus aureus in staphylococcal scalded skin syndrome among children in Korea. J Korean Med Sci. 2021;36(3):e22. https://doi.org/10.3346/jkms.2021.36.e22ChoiJHLeeHChoiEHAntimicrobial resistance and molecular analysis of Staphylococcus aureus in staphylococcal scalded skin syndrome among children in KoreaJ Korean Med Sci2021363e22https://doi.org/10.3346/jkms.2021.36.e2210.3346/jkms.2021.36.e22781358633463096Search in Google Scholar
EUCAST. Antimicrobial susceptibility testing EUCAST disk diffusion method. Version 8.0 January 2020. Basel (Switzerland): The European Committee on Antimicrobial Susceptibility Testing; 2020 [cited 2022 Apr 8]. Available from https://www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files/Disk_test_documents/2020_manuals/Manual_v_8.0_EUCAST_Disk_Test_2020.pdfEUCAST. Antimicrobial susceptibility testing EUCAST disk diffusion method. Version 8.0 January2020Basel (Switzerland)The European Committee on Antimicrobial Susceptibility Testing2020 [cited 2022 Apr 8]. Available fromhttps://www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files/Disk_test_documents/2020_manuals/Manual_v_8.0_EUCAST_Disk_Test_2020.pdfSearch in Google Scholar
Gagliotti C, Högberg LD, Billström H, Eckmanns T, Giske CG, Heuer OE, Jarlier V, Kahlmeter G, Lo Fo Wong D, Monen J, et al.; EARS-Net study group participants. Staphylococcus aureus bloodstream infections: diverging trends of meticillin-resistant and meticillin-susceptible isolates, EU/EEA, 2005 to 2018. Euro Surveill. 2021 Nov 18;26(46):2002094. https://doi.org/10.2807/1560-7917.ES.2021.26.46.2002094GagliottiCHögbergLDBillströmHEckmannsTGiskeCGHeuerOEJarlierVKahlmeterGLoFo Wong DMonenJet alEARS-Net study group participants. Staphylococcus aureus bloodstream infections: diverging trends of meticillin-resistant and meticillin-susceptible isolates, EU/EEA2005to 2018. Euro Surveill. 2021 Nov 1826462002094https://doi.org/10.2807/1560-7917.ES.2021.26.46.200209410.2807/1560-7917.ES.2021.26.46.2002094860340634794536Search in Google Scholar
He S, Deng Q, Liang B, Yu F, Yu X, Guo D, Liu X, Dong H. Suppressing alpha-hemolysin as potential target to screen of flavonoids to combat bacterial coinfection. Molecules. 2021 Dec 14;26(24):7577. https://doi.org/10.3390/molecules26247577HeSDengQLiangBYuFYuXGuoDLiuXDongHSuppressing alpha-hemolysin as potential target to screen of flavonoids to combat bacterial coinfectionMolecules2021Dec 1426247577https://doi.org/10.3390/molecules2624757710.3390/molecules26247577870938534946657Search in Google Scholar
Horino T, Hori S. Metastatic infection during Staphylococcus aureus bacteremia. J Infect Chemother. 2020 Feb;26(2):162–169. https://doi.org/10.1016/j.jiac.2019.10.003HorinoTHoriSMetastatic infection during Staphylococcus aureus bacteremiaJ Infect Chemother2020Feb262162169https://doi.org/10.1016/j.jiac.2019.10.00310.1016/j.jiac.2019.10.00331676266Search in Google Scholar
Jernigan JA, Hatfield KM, Wolford H, Nelson RE, Olubajo B, Reddy SC, McCarthy N, Paul P, McDonald LC, Kallen A, et al. Multidrug- resistant bacterial infections in U.S. hospitalized patients, 2012–2017. N Engl J Med. 2020 Apr 02;382(14):1309–1319. https://doi.org/10.1056/NEJMoa1914433JerniganJAHatfieldKMWolfordHNelsonREOlubajoBReddySCMcCarthyNPaulPMcDonaldLCKallenAet alMultidrug- resistant bacterial infections in U.Shospitalized patients, 2012–2017. N Engl J Med2020Apr 023821413091319https://doi.org/10.1056/NEJMoa191443310.1056/NEJMoa191443332242356Search in Google Scholar
Jorgensen SCJ, Lagnf AM, Bhatia S, Singh NB, Shammout LK, Davis SL, Rybak MJ. Diagnostic stewardship: A clinical decision rule for blood cultures in community-onset methicillin-resistant Staphylococcus aureus (MRSA) skin and soft tissue infections. Infect Dis Ther. 2019 Jun;8(2):229–242. https://doi.org/10.1007/s40121-019-0238-1JorgensenSCJLagnfAMBhatiaSSinghNBShammoutLKDavisSLRybakMJDiagnostic stewardship: A clinical decision rule for blood cultures in community-onset methicillin-resistant Staphylococcus aureus (MRSA) skin and soft tissue infectionsInfect Dis Ther2019Jun82229242https://doi.org/10.1007/s40121-019-0238-110.1007/s40121-019-0238-1652257730783995Search in Google Scholar
Junnila J, Hirvioja T, Rintala E, Auranen K, Rantakokko-Jalava K, Silvola J, Lindholm L, Gröndahl-Yli-Hannuksela K, Marttila H, Vuopio J. Changing epidemiology of methicillin-resistant Staphylococcus aureus in a low endemicity area – new challenges for MRSA control. Eur J Clin Microbiol Infect Dis. 2020 Dec;39(12):2299–2307. https://doi.org/10.1007/s10096-020-03824-9JunnilaJHirviojaTRintalaEAuranenKRantakokko-JalavaKSilvolaJLindholmLGröndahl-Yli-HannukselaKMarttilaHVuopioJChanging epidemiology of methicillin-resistant Staphylococcus aureus in a low endemicity area – new challenges for MRSA controlEur J Clin Microbiol Infect Dis2020Dec391222992307https://doi.org/10.1007/s10096-020-03824-910.1007/s10096-020-03824-9766980031989375Search in Google Scholar
Kot B, Wierzchowska K, Piechota M, Gruzewska A. Antimicrobial resistance patterns in methicillin-resistant Staphylococcus aureus from patients hospitalized during 2015-2017 in hospitals in Poland. Med Princ Pract. 2020;29(1):61–68. https://doi.org/10.1159/000501788KotBWierzchowskaKPiechotaMGruzewskaAAntimicrobial resistance patterns in methicillin-resistant Staphylococcus aureus from patients hospitalized during 2015-2017 in hospitals in PolandMed Princ Pract20202916168https://doi.org/10.1159/00050178810.1159/000501788702485831256152Search in Google Scholar
Kourtis AP, Hatfield K, Baggs J, Mu Y, See I, Epson E, Nadle J, Kainer MA, Dumyati G, Petit S, et al.; Emerging Infections Program MRSA author group. Vital Signs: Epidemiology and recent trends in methicillin-resistant and in methicillin- susceptible Staphylococcus aureus bloodstream infections – United States. MMWR Morb Mortal Wkly Rep. 2019 Mar 08;68(9):214–219. https://doi.org/10.15585/mmwr.mm6809e1KourtisAPHatfieldKBaggsJMuYSeeIEpsonENadleJKainerMADumyatiGPetitSet alEmerging Infections Program MRSA author group. Vital Signs: Epidemiology and recent trends in methicillin-resistant and in methicillin- susceptible Staphylococcus aureus bloodstream infections – United StatesMMWR Morb Mortal Wkly Rep2019Mar 08689214219https://doi.org/10.15585/mmwr.mm6809e110.15585/mmwr.mm6809e1642196730845118Search in Google Scholar
Lebughe M, Phaku P, Niemann S, Mumba D, Peters G, Muyembe-Tamfum JJ, Mellmann A, Strauß L, Schaumburg F. The impact of the Staphylococcus aureus virulome on infection in a developing country: A cohort study. Front Microbiol. 2017 Aug 29;8(AUG):1662. https://doi.org/10.3389/fmicb.2017.01662LebugheMPhakuPNiemannSMumbaDPetersGMuyembe-TamfumJJMellmannAStraußLSchaumburgFThe impact of the Staphylococcus aureus virulome on infection in a developing country: A cohort studyFront Microbiol2017Aug 298AUG1662https://doi.org/10.3389/fmicb.2017.0166210.3389/fmicb.2017.01662558193428900424Search in Google Scholar
Li X, Huang T, Xu K, Li C, Li Y. Molecular characteristics and virulence gene profiles of Staphylococcus aureus isolates in Hainan, China. BMC Infect Dis. 2019 Dec;19(1):873. https://doi.org/10.1186/s12879-019-4547-5LiXHuangTXuKLiCLiYMolecular characteristics and virulence gene profiles of Staphylococcus aureus isolates in Hainan, ChinaBMC Infect Dis2019Dec191873https://doi.org/10.1186/s12879-019-4547-510.1186/s12879-019-4547-5680558231640587Search in Google Scholar
Li Z, Zhuang H, Wang G, Wang H, Dong Y. Prevalence, predictors, and mortality of bloodstream infections due to methicillin-resistant Staphylococcus aureus in patients with malignancy: Systemic review and meta-analysis. BMC Infect Dis. 2021 Dec;21(1):74. https://doi.org/10.1186/s12879-021-05763-yLiZZhuangHWangGWangHDongYPrevalence, predictors, and mortality of bloodstream infections due to methicillin-resistant Staphylococcus aureus in patients with malignancy: Systemic review and meta-analysisBMC Infect Dis2021Dec21174https://doi.org/10.1186/s12879-021-05763-y10.1186/s12879-021-05763-y780979833446122Search in Google Scholar
Liu B, Sun H, Pan Y, Zhai Y, Cai T, Yuan X, Gao Y, He D, Liu J, Yuan L, et al. Prevalence, resistance pattern, and molecular characterization of Staphylococcus aureus isolates from healthy animals and sick populations in Henan Province, China. Gut Pathog. 2018 Jul 17;10(1):31. https://doi.org/10.1186/s13099-018-0254-9LiuBSunHPanYZhaiYCaiTYuanXGaoYHeDLiuJYuanLet alPrevalence, resistance pattern, and molecular characterization of Staphylococcus aureus isolates from healthy animals and sick populations in Henan Province, ChinaGut Pathog2018Jul 1710131https://doi.org/10.1186/s13099-018-0254-910.1186/s13099-018-0254-9604877430026814Search in Google Scholar
Lu H, Zhao L, Si Y, Jian Y, Wang Y, Li T, Dai Y, Huang Q, Ma X, He L, et al. The surge of hypervirulent ST398 MRSA lineage with >higher biofilm-forming ability is a critical threat to clinics. Front Microbiol. 2021 Mar 4;12(March):636788. https://doi.org/10.3389/fmicb.2021.636788LuHZhaoLSiYJianYWangYLiTDaiYHuangQMaXHeLet alThe surge of hypervirulent ST398 MRSA lineage with >higher biofilm-forming ability is a critical threat to clinicsFront Microbiol2021Mar 412March636788https://doi.org/10.3389/fmicb.2021.63678810.3389/fmicb.2021.636788796981533746929Search in Google Scholar
Maalej SM, Trabelsi JJ, Claude-alexandre G, Boutiba I, Mastouri M, Besbes S, Barguellil F, Laurent F, Hammami A. Antimicrobial susceptibility and molecular epidemiology of methicillin-resistant Staphylococcus aureus in Tunisia: Results of a multicenter study. J Infect Dis Epidemiol. 2019 Mar 11;5(2):071. https://doi.org/10.23937/2474-3658/1510071MaalejSMTrabelsiJJClaude-alexandreGBoutibaIMastouriMBesbesSBarguellilFLaurentFHammamiAAntimicrobial susceptibility and molecular epidemiology of methicillin-resistant Staphylococcus aureus in Tunisia: Results of a multicenter studyJ Infect Dis Epidemiol2019Mar 1152071https://doi.org/10.23937/2474-3658/151007110.23937/2474-3658/1510071Search in Google Scholar
Mariutti RB, Tartaglia NR, Seyffert N, de Paula Castro T, Arni RK, Azevedo VA, Le Loir Y, Nishifuji K. Exfoliative toxins of Staphylococcus aureus. In: Enany S, Alexander LEC, editors. The rise of virulence and antibiotic resistance in Staphylococcus aureus. London (UK): IntechOpen; 2017. https://doi.org/10.5772/66528MariuttiRBTartagliaNRSeyffertNdePaula Castro TArniRKAzevedoVALeLoir YNishifujiKExfoliative toxins of Staphylococcus aureusInEnanySAlexanderLECeditorsThe rise of virulence and antibiotic resistance in Staphylococcus aureusLondon (UK)IntechOpen2017https://doi.org/10.5772/6652810.5772/66528Search in Google Scholar
Mohseni M, Rafiei F, Ghaemi EA. High frequency of exfoliative toxin genes among Staphylococcus aureus isolated from clinical specimens in the north of Iran: Alarm for the health of individuals under risk. Iran J Microbiol. 2018 Jun; 10(3):158–165.MohseniMRafieiFGhaemiEAHigh frequency of exfoliative toxin genes among Staphylococcus aureus isolated from clinical specimens in the north of Iran: Alarm for the health of individuals under riskIran J Microbiol2018Jun103158165Search in Google Scholar
Naorem RS, Pangabam BD, Bora SS, Goswami G, Barooah M, Hazarika DJ, Fekete C. Identification of putative vaccine and drug targets against the methicillin-resistant Staphylococcus aureus by reverse vaccinology and subtractive genomics approaches. Molecules. 2022 Mar 24;27(7):2083. https://doi.org/10.3390/molecules27072083NaoremRSPangabamBDBoraSSGoswamiGBarooahMHazarikaDJFeketeCIdentification of putative vaccine and drug targets against the methicillin-resistant Staphylococcus aureus by reverse vaccinology and subtractive genomics approachesMolecules2022Mar 242772083https://doi.org/10.3390/molecules2707208310.3390/molecules27072083900051135408485Search in Google Scholar
Nisar S, Kirkpatrick LD, Shupp JW. Bacterial virulence factors and their contribution to pathophysiology after thermal injury. Surg Infect (Larchmt). 2021 Feb;22(1):69–76. https://doi.org/10.1089/sur.2020.188NisarSKirkpatrickLDShuppJWBacterial virulence factors and their contribution to pathophysiology after thermal injurySurg Infect (Larchmt)2021Feb2216976https://doi.org/10.1089/sur.2020.18810.1089/sur.2020.18832735479Search in Google Scholar
Okwu MU, Olley M, Akpoka AO, Izevbuwa OE. Methicillin-resistant Staphylococcus aureus (MRSA) and anti-MRSA activities of extracts of some medicinal plants: A brief review. AIMS Microbiol. 2019 Apr 15;5(2):117–137. https://doi.org/10.3934/microbiol.2019.2.117OkwuMUOlleyMAkpokaAOIzevbuwaOEMethicillin-resistant Staphylococcus aureus (MRSA) and anti-MRSA activities of extracts of some medicinal plants: A brief reviewAIMS Microbiol2019Apr 1552117137https://doi.org/10.3934/microbiol.2019.2.11710.3934/microbiol.2019.2.117664290731384707Search in Google Scholar
Pannewick B, Baier C, Schwab F, Vonberg RP. Infection control measures in nosocomial MRSA outbreaks – Results of a systematic analysis. PLoS One. 2021 Apr 7;16(4):e0249837. https://doi.org/10.1371/journal.pone.0249837PannewickBBaierCSchwabFVonbergRPInfection control measures in nosocomial MRSA outbreaks – Results of a systematic analysisPLoS One2021Apr 7164e0249837https://doi.org/10.1371/journal.pone.024983710.1371/journal.pone.0249837802605633826678Search in Google Scholar
Papadimitriou-Olivgeris M, Drougka E, Fligou F, Dodou V, Kolonitsiou F, Filos KS, Anastassiou ED, Petinaki E, Marangos M, Spiliopoulou I. Spread of Tst-positive Staphylococcus aureus strains belonging to ST30 clone among patients and healthcare workers in two intensive care units. Toxins (Basel). 2017 Sep 4;9(9):270. https://doi.org/10.3390/TOXINS9090270Papadimitriou-OlivgerisMDrougkaEFligouFDodouVKolonitsiouFFilosKSAnastassiouEDPetinakiEMarangosMSpiliopoulouISpread of Tst-positive Staphylococcus aureus strains belonging to ST30 clone among patients and healthcare workers in two intensive care unitsToxins (Basel)2017Sep 499270https://doi.org/10.3390/TOXINS909027010.3390/toxins9090270561820328869541Search in Google Scholar
Park KH, Greenwood-Quaintance KE, Cunningham SA, Raja-gopalan G, Chia N, Jeraldo PR, Mandrekar J, Patel R. Lack of correlation of virulence gene profiles of Staphylococcus aureus bacteremia isolates with mortality. Microb Pathog. 2019 Aug;133:103543. https://doi.org/10.1016/j.micpath.2019.103543ParkKHGreenwood-QuaintanceKECunninghamSARaja-gopalanGChiaNJeraldoPRMandrekarJPatelRLack of correlation of virulence gene profiles of Staphylococcus aureus bacteremia isolates with mortalityMicrob Pathog2019Aug133103543https://doi.org/10.1016/j.micpath.2019.10354310.1016/j.micpath.2019.10354331102653Search in Google Scholar
Peterson JC, Durkee H, Miller D, Maestre-Mesa J, Arboleda A, Aguilar MC, Relhan N, Flynn HW Jr, Amescua G, Parel JM, et al. Molecular epidemiology and resistance profiles among healthcare-and community-associated Staphylococcus aureus keratitis isolates. Infect Drug Resist. 2019 Apr;12:831–843. https://doi.org/10.2147/IDR.S190245PetersonJCDurkeeHMillerDMaestre-MesaJArboledaAAguilarMCRelhanNFlynnHW JrAmescuaGParelJMet alMolecular epidemiology and resistance profiles among healthcare-and community-associated Staphylococcus aureus keratitis isolatesInfect Drug Resist2019Apr12831843https://doi.org/10.2147/IDR.S19024510.2147/IDR.S190245646946931043797Search in Google Scholar
Pomorska-Wesołowska M, Różańska A, Natkaniec J, Gryglewska B, Szczypta A, Dzikowska M, Chmielarczyk A, Wójkowska-Mach J. Longevity and gender as the risk factors of methicillin-resistant Staphylococcus aureus infections in southern Poland. BMC Geriatr. 2017 Dec;17(1):51. https://doi.org/10.1186/s12877-017-0442-3Pomorska-WesołowskaMRóżańskaANatkaniecJGryglewskaBSzczyptaADzikowskaMChmielarczykAWójkowska-MachJLongevity and gender as the risk factors of methicillin-resistant Staphylococcus aureus infections in southern PolandBMC Geriatr2017Dec17151https://doi.org/10.1186/s12877-017-0442-310.1186/s12877-017-0442-3530324328187785Search in Google Scholar
Rahman MM, Amin KB, Rahman SMM, Khair A, Rahman M, Hossain A, Rahman AKMA, Parvez MS, Miura N, Alam MM. Investigation of methicillin-resistant Staphylococcus aureus among clinical isolates from humans and animals by culture methods and multiplex PCR. BMC Vet Res. 2018 Oct 3;14(1):300. https://doi.org/10.1186/s12917-018-1611-0RahmanMMAminKBRahmanSMMKhairARahmanMHossainARahmanAKMAParvezMSMiuraNAlamMMInvestigation of methicillin-resistant Staphylococcus aureus among clinical isolates from humans and animals by culture methods and multiplex PCRBMC Vet Res2018Oct 3141300https://doi.org/10.1186/s12917-018-1611-010.1186/s12917-018-1611-0616906430285752Search in Google Scholar
Rasheed NA, Hussein NR. Characterization of different virulent factors in methicillin-resistant Staphylococcus aureus isolates recovered from Iraqis and Syrian refugees in Duhok city, Iraq. PLoS One. 2020 Aug 17;15(8):e0237714. https://doi.org/10.1371/journal.pone.0237714RasheedNAHusseinNRCharacterization of different virulent factors in methicillin-resistant Staphylococcus aureus isolates recovered from Iraqis and Syrian refugees in Duhok city, IraqPLoS One2020Aug 17158e0237714https://doi.org/10.1371/journal.pone.023771410.1371/journal.pone.0237714743075332804961Search in Google Scholar
Schulz M, Calabrese S, Hausladen F, Wurm H, Drossart D, Stock K, Sobieraj AM, Eichenseher F, Loessner MJ, Schmelcher M, et al. Point-of-care testing system for digital single cell detection of MRSA directly from nasal swabs. Lab Chip. 2020 Jul 14;20(14):2549–2561. https://doi.org/10.1039/D0LC00294ASchulzMCalabreseSHausladenFWurmHDrossartDStockKSobierajAMEichenseherFLoessnerMJSchmelcherMet alPoint-of-care testing system for digital single cell detection of MRSA directly from nasal swabsLab Chip2020Jul 14201425492561https://doi.org/10.1039/D0LC00294A10.1039/D0LC00294A32568322Search in Google Scholar
Shahini Shams-Abadi M, Halaji M, Hoseini-Alfatemi SM, Gholipour A, Mojtahedi A, Sedigh Ebrahim-Saraie H. Epidemiology of toxic shock syndrome toxin-1 harboring Staphylococcus aureus obtained from clinical samples in Iran: A systematic review and meta-analysis. Ann Ig. 2018 Sep–Oct;30(5):391–400. https://doi.org/10.7416/ai.2018.2239ShahiniShams-Abadi MHalajiMHoseini-AlfatemiSMGholipourAMojtahediASedighEbrahim-Saraie HEpidemiology of toxic shock syndrome toxin-1 harboring Staphylococcus aureus obtained from clinical samples in Iran: A systematic review and meta-analysisAnn Ig2018Sep–Oct305391400https://doi.org/10.7416/ai.2018.2239Search in Google Scholar
Shettigar K, Murali TS. Virulence factors and clonal diversity of Staphylococcus aureus in colonization and wound infection with emphasis on diabetic foot infection. Eur J Clin Microbiol Infect Dis. 2020 Dec;39(12):2235–2246. https://doi.org/10.1007/s10096-020-03984-8ShettigarKMuraliTSVirulence factors and clonal diversity of Staphylococcus aureus in colonization and wound infection with emphasis on diabetic foot infectionEur J Clin Microbiol Infect Dis2020Dec391222352246https://doi.org/10.1007/s10096-020-03984-810.1007/s10096-020-03984-8766977932683595Search in Google Scholar
Thorlacius-Ussing L, Sandholdt H, Larsen AR, Petersen A, Benfield T. Age-dependent increase in incidence of Staphylococcus aureus bacteremia, Denmark, 2008–2015. Emerg Infect Dis. 2019 May;25(5):875–882. https://doi.org/10.3201/eid2505.181733Thorlacius-UssingLSandholdtHLarsenARPetersenABenfieldTAge-dependent increase in incidence of Staphylococcus aureus bacteremia, Denmark, 2008–2015Emerg Infect Dis2019May255875882https://doi.org/10.3201/eid2505.18173310.3201/eid2505.181733647819631002300Search in Google Scholar
Tong SYC, Davis JS, Eichenberger E, Holland TL, Fowler VG Jr. Staphylococcus aureus infections: epidemiology, pathophysiology, clinical manifestations, and management. Clin Microbiol Rev. 2015 Jul;28(3):603–661. https://doi.org/10.1128/CMR.00134-14TongSYCDavisJSEichenbergerEHollandTLFowlerVGJrStaphylococcus aureus infections: epidemiology, pathophysiology, clinical manifestations, and managementClin Microbiol Rev2015Jul283603661https://doi.org/10.1128/CMR.00134-1410.1128/CMR.00134-14445139526016486Search in Google Scholar
Tsuzuki S, Matsunaga N, Yahara K, Shibayama K, Sugai M, Ohmagari N. Disease burden of bloodstream infections caused by antimicrobial-resistant bacteria: A population-level study, Japan, 2015–2018. Int J Infect Dis. 2021 Jul;108:119–124. https://doi.org/10.1016/j.ijid.2021.05.018TsuzukiSMatsunagaNYaharaKShibayamaKSugaiMOhmagariNDisease burden of bloodstream infections caused by antimicrobial-resistant bacteria: A population-level study, Japan, 2015–2018Int J Infect Dis2021Jul108119124https://doi.org/10.1016/j.ijid.2021.05.01810.1016/j.ijid.2021.05.01833992765Search in Google Scholar
Tuffs SW, Herfst CA, Baroja ML, Podskalniy VA, DeJong EN, Coleman CEM, McCormick JK. Regulation of toxic shock syndrome toxin‐1 by the accessory gene regulator in Staphylococcus aureus is mediated by the repressor of toxins. Mol Microbiol. 2019 Oct;112(4):1163–1177. https://doi.org/10.1111/mmi.14353TuffsSWHerfstCABarojaMLPodskalniyVADeJongENColemanCEMMcCormickJKRegulation of toxic shock syndrome toxin‐1 by the accessory gene regulator in Staphylococcus aureus is mediated by the repressor of toxinsMol Microbiol2019Oct112411631177https://doi.org/10.1111/mmi.1435310.1111/mmi.1435331321813Search in Google Scholar
Turner NA, Sharma-Kuinkel BK, Maskarinec SA, Eichenberger EM, Shah PP, Carugati M, Holland TL, Fowler VG Jr. Methicillin-resistant Staphylococcus aureus: An overview of basic and clinical research. Nat Rev Microbiol. 2019 Apr;17(4):203–218. https://doi.org/10.1038/s41579-018-0147-4TurnerNASharma-KuinkelBKMaskarinecSAEichenbergerEMShahPPCarugatiMHollandTLFowlerVGJrMethicillin-resistant Staphylococcus aureus: An overview of basic and clinical researchNat Rev Microbiol2019Apr174203218https://doi.org/10.1038/s41579-018-0147-410.1038/s41579-018-0147-4693988930737488Search in Google Scholar
Uehara Y. Current status of staphylococcal cassette chromosome mec (SCCmec). Antibiotics (Basel). 2022 Jan 11;11(1):86. https://doi.org/10.3390/antibiotics11010086UeharaYCurrent status of staphylococcal cassette chromosome mec (SCCmec)Antibiotics (Basel)2022Jan 1111186https://doi.org/10.3390/antibiotics1101008610.3390/antibiotics11010086877272635052963Search in Google Scholar
Urushibara N, Aung MS, Kawaguchiya M, Kobayashi N. Novel staphylococcal cassette chromosome mec (SCCmec) type XIV (5A) and a truncated SCCmec element in SCC composite islands carrying speG in ST5 MRSA in Japan. J Antimicrob Chemother. 2020 Jan 1;75(1):46–50. https://doi.org/10.1093/jac/dkz406UrushibaraNAungMSKawaguchiyaMKobayashiNNovel staphylococcal cassette chromosome mec (SCCmec) type XIV (5A) and a truncated SCCmec element in SCC composite islands carrying speG in ST5 MRSA in JapanJ Antimicrob Chemother2020Jan 17514650https://doi.org/10.1093/jac/dkz40610.1093/jac/dkz40631617906Search in Google Scholar
Zhao H, Xu S, Yang H, He C, Xu X, Hu F, Shu W, Gong F, Zhang C, Liu Q. Molecular typing and variations in amount of tst gene expression of TSST-1-producing clinical Staphylococcus aureus isolates. Front Microbiol. 2019 Jun 19;10(JUN):1388. https://doi.org/10.3389/fmicb.2019.01388ZhaoHXuSYangHHeCXuXHuFShuWGongFZhangCLiuQMolecular typing and variations in amount of tst gene expression of TSST-1-producing clinical Staphylococcus aureus isolatesFront Microbiol2019Jun 1910JUN1388https://doi.org/10.3389/fmicb.2019.0138810.3389/fmicb.2019.01388659435631275293Search in Google Scholar
Zhou W, Wu R, Duraiswamy S, Wang W, Zhu L, Wang Z. Development of microfluidic cartridge for culture-free detection of Staphylococcus aureus in blood. J Micromech Microeng. 2021 May 01; 31(5):055012. https://doi.org/10.1088/1361-6439/abf32fZhouWWuRDuraiswamySWangWZhuLWangZDevelopment of microfluidic cartridge for culture-free detection of Staphylococcus aureus in bloodJ Micromech Microeng2021May 01315055012https://doi.org/10.1088/1361-6439/abf32f10.1088/1361-6439/abf32fSearch in Google Scholar
