1. bookVolumen 71 (2022): Edición 4 (December 2022)
Detalles de la revista
License
Formato
Revista
eISSN
2544-4646
Primera edición
04 Mar 1952
Calendario de la edición
4 veces al año
Idiomas
Inglés
Acceso abierto

Screening of Toxin Genes in Methicillin-Resistant Staphylococcus aureus Clinical Isolates from a Hospital Setting in a Tertiary Hospital in Northern Cyprus

Publicado en línea: 12 Nov 2022
Volumen & Edición: Volumen 71 (2022) - Edición 4 (December 2022)
Páginas: 491 - 497
Recibido: 23 Jun 2022
Aceptado: 29 Aug 2022
Detalles de la revista
License
Formato
Revista
eISSN
2544-4646
Primera edición
04 Mar 1952
Calendario de la edición
4 veces al año
Idiomas
Inglés
Introduction

Methicillin-resistant Staphylococcus aureus (MRSA) represents one of the most concerning pathogens worldwide, responsible for community-acquired and hospital-acquired infections (Kourtis et al. 2019; Turner et al. 2019). According to the Centers for Disease Prevention and Control (CDC), antibiotic-resistant S. aureus causes over 2 million cases of disease and 23,000 deaths each year in the United States alone (Okwu et al. 2019). In addition to their intrinsic resistance to β-lactam antibiotics, hospital-associated MRSA strains often exhibit a variable yet alarming level of multi-drug resistance which narrows treatment alternatives to the limited remaining efficient drugs (Bispo et al. 2020; Jernigan et al. 2020).

The molecular characteristics of S. aureus can change over time, and the population structure varies regionally, according to epidemiological studies of S. aureus (Barcudi et al. 2020; Junnila et al. 2020; Lu et al. 2021). Over 94% of S. aureus strains are reported to be resistant to penicillin and its derivatives due to the release of the penicillinase enzyme, beta-lactamase, which inhibits penicillin by hydrolyzing the beta-lactam ring (Algammal et al. 2020). MRSA is characterized predominantly by the presence of either the mecA gene or its homologs mecB, mecC and mecD, that are located on the staphylococcal chromosomal cassette mec (SCCmec type I–XIV) and code for the penicillin-binding protein 2a (PBP2-a) that has a reduced affinity for beta-lactam antibiotics (Urushibara et al. 2020; Uehara 2022).

From a clinical perspective, the increasing use of molecular and other bioinformatics tools has facilitated the mapping of the S. aureus virulome and clarified its epidemiological and clinical significance. S. aureus generates an array of virulence factors that allow the bacteria to survive extreme conditions within the human host and damages biological membranes, resulting in cell death (Shettigar and Murali 2020; Nisar et al. 2021). S. aureus maintains fine control of the expression of virulence factors which include hemolysins, leukocidins, proteases, exfoliative toxins, enterotoxins, and immunemodulatory factors.

The development of clinical management and infection control policies presents a significant challenge as there is still insufficient data on the infection transmission rate and clone characteristics. It is, therefore, of paramount importance to investigate the epidemiology and the molecular profile of S. aureus. The current study aims to characterize toxin-associated virulence determinants in a wide range of clinical isolates in a previously understudied region of Northern Cyprus.

Experimental
Materials and Methods

Clinical isolates. In total, 91 clinical non-repetitive S. aureus strains isolated between January 2012 and November 2020, identified initially to be MRSA by BD Phoenix 100 automated identification and antibiotic susceptibility system, were collected and investigated in this study. Isolates were cultured from wound/ abscess, blood, bronchoalveolar lavage, nasal swab, tracheal aspiration, and sputum samples from different departments at the Near East University Hospital in Northern Cyprus.

Identification and phenotypic detection of methicillin resistance. All isolates were cultured on sheep blood agar. Agar plates were incubated at 35°C for 24–48 h in 5% CO2. The isolates were subsequently confirmed as S. aureus based on colony morphology and ability to coagulate human plasma. Methicillin resistance was assessed using the disc diffusion method with cefoxitin (30 μg) (Bioanalyse, Turkey) on Mueller-Hinton agar (Difco, Becton Dickinson, USA) plates. Antibiotic susceptibility was assessed with the European Committee on Antimicrobial Susceptibility Testing guidelines (EUCAST 2020).

DNA extraction. Rapid extraction of genomic DNA was performed with the boiling method described by Barbosa et al. (2016). Briefly, a few colonies cultured on blood agar were suspended in nuclease-free water in a microcentrifuge tube. The cell suspension was then incubated at 100°C for 15 min and centrifuged at 13,000 rpm for 5 min to sediment the debris. After centrifugation, the supernatant was collected and utilized as a DNA template in polymerase chain reaction (PCR) reactions.

Molecular identification of the isolates. The preliminary identification procedures were followed by the PCR analysis using S. aureus species-specific thermonuclease (nuc) primers, as previously shown (Amin et al. 2020). The nuc gene was amplified in a 25-μl reaction which contained: PCR Master Mix 2× (Thermo Fisher Scientific, USA), Taq DNA polymerase (0.05 U/μl), 0.4 mM of each dNTP, 4 mM MgCl2, 4 μl of template DNA, and 10 pmol of forward and reverse primer nuc-F 5’-GCGATTGATGGTGATACGGTT-3’, nuc-R 5’-AGCCAAGCCTTGACGAACTAAAGC-3’. DNA amplification was performed involving denaturation at 94°C for 10 min, 30 cycles at 94°C for 30 s, 55°C for 30 s, and 72°C for 1 min, and a final elongation step at 72°C for 5 min. The PCR detection of mecA confirmed the methicillin resistance. Amplification was achieved as described before (Rahman et al. 2018) except for a denaturation step at 94°C for 10 min. The strain of S. aureus SCCmec type IV (mecA+, pvl, nuc+) was used as a positive control. Distilled water was used as a negative control. Verification of PCR products was obtained using 1.5% agarose gel. Ethidium bromide was used for staining the gels, and amplicons were observed with MiniBIS Pro Gel Documentation Platform (DNR, Israel).

Screening for virulence genes in MRSA. The occurrence of virulence-associated genes was investigated by PCR detection of hla, eta, etb, etd and tst in all confirmed MRSA isolates. Single PCR reactions were performed as described above. PCR amplification for each primer set was performed using Bio-Rad MyCycler Thermal Cycler (Bio-Rad Laboratories, Israel) according to the cycling parameters summarized in Table I. PCR products were analyzed with gel electrophoresis through 2% agarose gel and visualized using a transilluminator. The positive controls included the genomic DNA from isolates in which the presence of the genes mentioned above was formerly found in the genome.

Oligonucleotides used in this study.

Target Sequence (from 5’ to 3’) Product size (bp) Annealing temp. (°C) Reference
mecA
Forward AAAATCGATGGTAAAGGTTGGC 533 55 Kot et al. 2020
Reverse AGTTCTGCAGTACCGGATTTGC
nuc
Forward GCGATTGATGGTGATACGGTT 279 55 Amin et al. 2020
Reverse AGCCAAGCCTTGACGAACTAAAGC
hla
Forward CTGATTACTATCCAAGAAATTCGATTG 209 57 Rasheed and Hussein 2020
Reverse CTTTCCAGCCTACTTTTTTATCAGT
eta
Forward GCAGGTGTTGATTTAGCATT 93 58 Rasheed and Hussein 2020
Reverse AGATGTCCCTATTTTTGCTG
etb
Forward ACAAGCAAAAGAATACAGCG
Reverse GTTTTTGGCTGCTTCTCTTG 226 50 Rasheed and Hussein 2020
etd
Forward AACTATCATGTATCAAGG 376 47 Liu et al. 2018
Reverse CAGAATTTCCCGACTCAG
tst
Forward ACCCCTGTTCCCTTATCATC
Reverse TTTTCAGTATTTGTAACGCC 326 57 Rasheed and Hussein 2020

Statistical analysis. Statistical data analysis was performed using SPSS Version 25.0 (SPSS, Inc., USA). Comparison of variables was achieved using independent t-tests and Chi-square test of association. A p-Value of ≤ 0.05 was considered statistically significant.

Ethics approval. The Institutional Review Board approved this study at Near East University with a waiver of patient consent (YDU/2020/80-1115, YDU/ 2021/90-1331).

Results

Patients features. A total of 91 non-duplicate samples were initially screened. Of these, 80.85% (76/91) strains were identified as MRSA using phenotypic and genotypic methods, among which 57.9% (44/76) were recovered from male patients. The distribution of isolates according to patient admission status indicated that 75% (57/76) of the isolates were obtained from inpatients. Despite the predominance of the male gender, no statistically significant difference was observed in gender distribution across inpatient and outpatient groups (p = 0.107) (Table II). Patient age at admission ranged from 1 to 99 years (mean: 60.16, median: 63.00, standard deviation: 22.21), and the majority of patients with MRSA infection were over the age of 45 (p < 0.005) (Table II) with the inpatients group being significantly older (p < 0.001). No significant association was observed between patient age and gender (p = 0.901).

Distribution of MRSA isolates according to age, gender, and admission status.

Demographic data n (%) p-value
Age groups
Under 15 2 (2.6) < 0.005
15–44 16 (21.1)
45–64 22 (28.9)
65 and above 36 (47.4)
Gender
Male 44 (57.9) 0.107
Female 32 (42.1)
Admissions
Inpatients 57 (75) < 0.001
Outpatients 19 (25)

Majority of the isolates obtained in this study originated from patients admitted to cardiology (n = 14; 18.4%), pulmonary infections (n = 10; 13.2%), infectious diseases (n = 10; 13.2%), anesthesiology (n = 7; 9.2%), orthopedics and traumatology (n = 6; 7.9%), cardiovascular surgery (n = 5; 6.6%), general surgery (n = 5; 6.6%), neurosurgery (n = 4; 5.3%), dermatology (n = 4; 5.3%), brain surgery (n = 2; 2.6%), gastroenterology (n = 2; 2.6%), intensive care unit (n = 2; 2.6%), and the remaining departments; dialysis, neurology, plastic surgery, urology, and pediatrics (n = 5; 6.6%). The distribution of isolates by the hospital department is shown in Table III.

Distribution of MRSA isolates according to the hospital department.

Department n (%)
Cardiology 14 (18.4)
Pulmonary infections 10 (13.2)
Infectious diseases 10 (13.2)
Anesthesiology   7 (9.2)
Orthopedics and traumatology   6 (7.9)
Cardiovascular surgery   5 (6.6)
General surgery   5 (6.6)
Dermatology   4 (5.3)
Neurosurgery   4 (5.3)
Brain surgery   2 (2.6)
Gastroenterology   2 (2.6)
Intensive care unit   2 (2.6)
Dialysis   1 (1.3)
Neurology   1 (1.3)
Pediatrics   1 (1.3)
Plastic surgery   1 (1.3)
Urology   1 (1.3)
Total 76 (100)

Majority of the samples from which MRSA were cultured were isolated from abscess-wound (n = 19; 25.0%), blood (n = 17; 22.4%), nasal swabs (n = 13; 17.1%), and tracheal aspirates (n = 13; 17.1%). The distribution of the isolates according to the sample type is given in Table IV.

Distribution of MRSA isolates according to the sample source.

Sample source n (%)
Abscess-wound 19 (25.0)
Blood 17 (22.4)
Nasal swab 13 (17.1)
Tracheal aspirate 13 (17.1)
Sputum   5 (6.6)
Urine   4 (5.3)
Catheter tip   3 (3.9)
Bronchioalveolar lavage   1 (1.3)
Urethral swab   1 (1.3)
Total 76 (100)

Confirmation of MRSA isolates. Seventy-six isolates that were found to be non-susceptible to cefoxitin in the disc diffusion assay were verified to be MRSA with the amplification of the mecA gene via single-target PCR. The presence of the mecA gene is demonstrated in Fig. 1.

Fig. 1

Molecular detection of the nuc, mecA, exfA, exfB, tst and hla genes by single target PCR. PC – positive control, NC – negative control, M – 100 bp DNA ladder (Hibrigen) for mecA (533 bp) and tst (326 bp), 50 bp DNA ladder (Hibrigen) for nuc (270 bp), exfA (93 bp), exfB 226 bp) and hla (209 bp), bp – base pairs

Detection of virulence determinants. Among the investigated virulence genes, the α-toxin encoding gene (hla) was found in 97.3% (n = 74/76) of the isolates and it was the most frequently virulence gene detected. Among the MRSA isolates, the frequencies of exfoliative toxin A, B, D and TSST-1 encoding genes (eta, etb, etd, tst) were 2.63% (n = 2/76), 1.3%, (n = 1/76), 0%, and 2.63% (n = 2/76), respectively.

Discussion

MRSA represents a significant public health threat, particularly in developing countries owing to its ability to lead to life-threatening infections (Li et al. 2021; Pannewick et al. 2021). Regarding MRSA-induced infections and their burden in healthcare, studies focusing on regional epidemiology have demonstrated significant differences among regions (Gagliotti et al. 2021; Tsuzuki et al. 2021). For the first time, our present study provides insights into multiple virulence characteristics of S. aureus from clinical specimens in Northern Cyprus.

In the current study, at a trend analysis level, although the gender of the patients had no statistical association with the detection of MRSA, the isolation rate was markedly higher in males. MRSA infections occur less frequently in patients below 45 years of age. Both age and gender-related trends observed in this study were similar to those previously investigated by others (Pomorska-Wesołowska et al. 2017; Thorlacius-Ussing et al. 2019). The isolation frequency of MRSA was highest in wounds and abscesses (25%; n = 19/76) and blood samples (22%; n = 17/76). These findings reinforce the association of skin and soft tissue infections (SSTIs) as a predisposing factor to S. aureus bacteremia (Jorgensen et al. 2019; Horino and Hori 2020).

The effects of S. aureus virulome on the progression of infections have been broadly investigated (Lebughe et al. 2017; Park et al. 2019). While virulence genes can play an important role in the pathogenicity of S. aureus, the circulation of these genes may vary among strains. Therefore, defining the distribution of virulence-associated genes is invaluable for the epidemiological control of S. aureus. The hla gene was detected in 97% of MRSA strains and had the highest frequency of all genes among the virulence factors investigated. This finding is comparable to another study in China in which authors reported that 98.7% (n = 224/227) of the S. aureus isolates were hla-positive (Li et al. 2019). In a separate investigation conducted in Iraq in 2020, S. aureus strains isolated from Syrian and Iraqi refugees were screened, and the hla gene was found in 93.4% (n = 117/125) of the Iraqi community. In contrast, the frequency of hla positivity was 71.4% (n = 89/125) in the Syrian refugee group (Rasheed and Hussein 2020). Alpha-hemolysin is by far the most well studied among the S. aureus cytotoxins, as it is produced by many strains and is toxic to a broad spectrum of mammalian cells.

Exfoliative toxins secreted by S. aureus are essential virulence factors of the bacterium. In our study eta was detected in 3% (n = 2) and etb in 1.5% (n = 1) of the isolates, whereas etd was not detected among the isolates tested. Our study results differed from those obtained by Mohseni et al. in 2018, in which a high frequency of eta (76.7%), etb (16.7%), and etd (54%) in S. aureus clinical isolates was observed. These findings contrast with a previous study in Korea on staphylococcal scalded skin syndrome patient-derived strains, which reported 53.8% of MRSA isolates to be etb-positive (Choi et al. 2021). According to the literature, eta is more common in Europe, Africa, and North America, contributing to over 80% of exfoliative toxin-producing strains, whereas etb is more common in Japan (Mariutti et al. 2017).

Toxic shock syndrome (TSS) manifests as either non-menstrual or menstrual-associated infection. However, cases of menstrual TSS are rarely seen (0.03–0.5/ 100.000), although the strains producing the toxin are often reported (Tong et al. 2015; Berger et al. 2019). It is suggests that the production of the toxin is under tight control (Tuffs et al. 2019). Only 3% (n = 2) of the isolates investigated in this study harbored the tst gene. In other studies, the prevalence of the toxin among the strains was found to be between 14% and 36.8% (Papadimitriou-Olivgeris et al. 2017; Shahini Shams-Abadi et al. 2018; Zhao et al. 2019; Abbasi Montazeri et al. 2021).

In this study, we gained insights into the prevalence of toxin genes among S. aureus clinical isolates. We also identified that the elderly and inpatient population were at high risk of developing an MRSA infection. These findings are invaluable for the genetic characterization of bacterial isolates circulating in Northern Cyprus and call our attention to the need for regular surveillance of MRSA epidemiology. In-depth studies covering the clonal diversity of MRSA strains and the correlation of antimicrobial resistance and toxin gene profiles with specific clones have highlighted these features as variables driving the complex epidemiology of this pathogen (Peterson et al. 2019; Maalej et al. 2019). The recent development of rapid diagnostic technologies contributes to the fast and reliable identification of infectious pathogens. For example, integrated sensing platforms using microfluidics technology and mass spectrometry techniques such as MALDI-TOF have significantly increased the rate of detection of MRSA in clinical samples (Schulz et al. 2020; Zhou et al. 2021). Concurrently, novel therapeutic approaches such as antivirulence drugs and phage therapy are being developed and hold promise for tackling antimicrobial resistance (He et al. 2021; Chang et al. 2022; Naorem et al. 2022).

Conclusion

The data presented indicate that while most strains carry the alpha-toxin gene, the frequency of tst, eta, etb, and etd genes were considerably low in the strains circulating at the main hospital in this region. Our results provide new epidemiological data of S. aureus strains in this region.

Limitations

This work represents a preliminary study with a limited sample size from a single center; therefore the data is not representative of isolates in all hospitals across Cyprus. Additional analyses with a higher number of isolates are required to identify the overall frequency of virulence determinants. Another limitation of the study was the absence of measurements of expression levels of the virulence factors at gene and protein levels.

Fig. 1

Molecular detection of the nuc, mecA, exfA, exfB, tst and hla genes by single target PCR. PC – positive control, NC – negative control, M – 100 bp DNA ladder (Hibrigen) for mecA (533 bp) and tst (326 bp), 50 bp DNA ladder (Hibrigen) for nuc (270 bp), exfA (93 bp), exfB 226 bp) and hla (209 bp), bp – base pairs
Molecular detection of the nuc, mecA, exfA, exfB, tst and hla genes by single target PCR. PC – positive control, NC – negative control, M – 100 bp DNA ladder (Hibrigen) for mecA (533 bp) and tst (326 bp), 50 bp DNA ladder (Hibrigen) for nuc (270 bp), exfA (93 bp), exfB 226 bp) and hla (209 bp), bp – base pairs

Distribution of MRSA isolates according to the sample source.

Sample source n (%)
Abscess-wound 19 (25.0)
Blood 17 (22.4)
Nasal swab 13 (17.1)
Tracheal aspirate 13 (17.1)
Sputum   5 (6.6)
Urine   4 (5.3)
Catheter tip   3 (3.9)
Bronchioalveolar lavage   1 (1.3)
Urethral swab   1 (1.3)
Total 76 (100)

Distribution of MRSA isolates according to age, gender, and admission status.

Demographic data n (%) p-value
Age groups
Under 15 2 (2.6) < 0.005
15–44 16 (21.1)
45–64 22 (28.9)
65 and above 36 (47.4)
Gender
Male 44 (57.9) 0.107
Female 32 (42.1)
Admissions
Inpatients 57 (75) < 0.001
Outpatients 19 (25)

Oligonucleotides used in this study.

Target Sequence (from 5’ to 3’) Product size (bp) Annealing temp. (°C) Reference
mecA
Forward AAAATCGATGGTAAAGGTTGGC 533 55 Kot et al. 2020
Reverse AGTTCTGCAGTACCGGATTTGC
nuc
Forward GCGATTGATGGTGATACGGTT 279 55 Amin et al. 2020
Reverse AGCCAAGCCTTGACGAACTAAAGC
hla
Forward CTGATTACTATCCAAGAAATTCGATTG 209 57 Rasheed and Hussein 2020
Reverse CTTTCCAGCCTACTTTTTTATCAGT
eta
Forward GCAGGTGTTGATTTAGCATT 93 58 Rasheed and Hussein 2020
Reverse AGATGTCCCTATTTTTGCTG
etb
Forward ACAAGCAAAAGAATACAGCG
Reverse GTTTTTGGCTGCTTCTCTTG 226 50 Rasheed and Hussein 2020
etd
Forward AACTATCATGTATCAAGG 376 47 Liu et al. 2018
Reverse CAGAATTTCCCGACTCAG
tst
Forward ACCCCTGTTCCCTTATCATC
Reverse TTTTCAGTATTTGTAACGCC 326 57 Rasheed and Hussein 2020

Distribution of MRSA isolates according to the hospital department.

Department n (%)
Cardiology 14 (18.4)
Pulmonary infections 10 (13.2)
Infectious diseases 10 (13.2)
Anesthesiology   7 (9.2)
Orthopedics and traumatology   6 (7.9)
Cardiovascular surgery   5 (6.6)
General surgery   5 (6.6)
Dermatology   4 (5.3)
Neurosurgery   4 (5.3)
Brain surgery   2 (2.6)
Gastroenterology   2 (2.6)
Intensive care unit   2 (2.6)
Dialysis   1 (1.3)
Neurology   1 (1.3)
Pediatrics   1 (1.3)
Plastic surgery   1 (1.3)
Urology   1 (1.3)
Total 76 (100)

Abbasi Montazeri E, Khosravi AD, Khazaei S, Sabbagh A. Prevalence of methicillin resistance and superantigenic toxins in Staphylococcus aureus strains isolated from patients with cancer. BMC Microbiol. 2021 Dec;21(1):262. https://doi.org/10.1186/s12866-021-02319-7 Abbasi Montazeri E Khosravi AD Khazaei S Sabbagh A Prevalence of methicillin resistance and superantigenic toxins in Staphylococcus aureus strains isolated from patients with cancer BMC Microbiol 2021 Dec211262 https://doi.org/10.1186/s12866-021-02319-710.1186/s12866-021-02319-7848260134587897Search in Google Scholar

Algammal AM, Hetta HF, Elkelish A, Alkhalifah DHH, Hozzein WN, Batiha GES, El Nahhas N, Mabrok MA. Methicillin-resistant Staphylococcus aureus (MRSA): One health perspective approach to the bacterium epidemiology, virulence factors, antibiotic-resistance, and zoonotic impact. Infect Drug Resist. 2020 Sep; 13:3255–3265. https://doi.org/10.2147/IDR.S272733 Algammal AM Hetta HF Elkelish A Alkhalifah DHH Hozzein WN Batiha GES El Nahhas N Mabrok MA Methicillin-resistant Staphylococcus aureus (MRSA): One health perspective approach to the bacterium epidemiology, virulence factors, antibiotic-resistance, and zoonotic impact Infect Drug Resist 2020 Sep 133255 3265 https://doi.org/10.2147/IDR.S27273310.2147/IDR.S272733751982933061472Search in Google Scholar

Amin DHM, Guler E, Baddal B. Prevalence of Panton-Valentine leukocidin in methicillin-resistant Staphylococcus aureus clinical isolates at a university hospital in Northern Cyprus: A pilot study. BMC Res Notes. 2020 Oct 20;13(1):490. https://doi.org/10.1186/s13104-020-05339-0 Amin DHM Guler E Baddal B Prevalence of Panton-Valentine leukocidin in methicillin-resistant Staphylococcus aureus clinical isolates at a university hospital in Northern Cyprus: A pilot study BMC Res Notes 2020 Oct 20131490 https://doi.org/10.1186/s13104-020-05339-010.1186/s13104-020-05339-0757672133081819Search in Google Scholar

Barbosa C, Nogueira S, Gadanho M, Chaves S. Chapter 7 – DNA extraction: finding the most suitable method. In: Cook N, D’Agostino M, Thompson KC, editors. Molecular microbial diagnostic methods. San Diego (USA): Academic Press; 2016. p. 135–154. https://doi.org/10.1016/B978-0-12-416999-9.00007-1 Barbosa C Nogueira S Gadanho M Chaves S Chapter 7 – DNA extraction: finding the most suitable method. In: Cook N, D’Agostino M, Thompson KC, editors. Molecular microbial diagnostic methods San Diego (USA) Academic Press; 2016 p 135 154 https://doi.org/10.1016/B978-0-12-416999-9.00007-110.1016/B978-0-12-416999-9.00007-1Search in Google Scholar

Barcudi D, Sosa EJ, Lamberghini R, Garnero A, Tosoroni D, Decca L, Gonzalez L, Kuyuk MA, Lopez T, Herrero I, et al.; Study Group of S. aureus in Córdoba, Argentina. MRSA dynamic circulation between the community and the hospital setting: new insights from a cohort study. J Infect. 2020 Jan;80(1):24–37. https://doi.org/10.1016/j.jinf.2019.10.001 Barcudi D Sosa EJ Lamberghini R Garnero A Tosoroni D Decca L Gonzalez L Kuyuk MA Lopez T Herrero I et al Study Group of S. aureus in Córdoba, Argentina. MRSA dynamic circulation between the community and the hospital setting: new insights from a cohort study J Infect 2020 Jan80124 37 https://doi.org/10.1016/j.jinf.2019.10.00110.1016/j.jinf.2019.10.00131606351Search in Google Scholar

Berger S, Kunerl A, Wasmuth S, Tierno P, Wagner K, Brügger J. Menstrual toxic shock syndrome: Case report and systematic review of the literature. Lancet Infect Dis. 2019 Sep;19(9):e313–e321. https://doi.org/10.1016/S1473-3099(19)30041-6 Berger S Kunerl A Wasmuth S Tierno P Wagner K Brügger J Menstrual toxic shock syndrome: Case report and systematic review of the literature Lancet Infect Dis 2019 Sep199e313 e321 https://doi.org/10.1016/S1473-3099(19)30041-610.1016/S1473-3099(19)30041-631151811Search in Google Scholar

Bispo PJM, Ung L, Chodosh J, Gilmore MS. Hospital-associated multidrug-resistant MRSA lineages are trophic to the ocular surface and cause severe microbial keratitis. Front Public Health. 2020 Jun 3;8:204. https://doi.org/10.3389/fpubh.2020.00204 Bispo PJM Ung L Chodosh J Gilmore MS Hospital-associated multidrug-resistant MRSA lineages are trophic to the ocular surface and cause severe microbial keratitis Front Public Health 2020 Jun 38204 https://doi.org/10.3389/fpubh.2020.0020410.3389/fpubh.2020.00204728349432582610Search in Google Scholar

Chang RYK, Nang SC, Chan HK, Li J. Novel antimicrobial agents for combating antibiotic-resistant bacteria. Adv Drug Deliv Rev. 2022 Aug;187:114378. https://doi.org/10.1016/j.addr.2022.114378 Chang RYK Nang SC Chan HK Li J Novel antimicrobial agents for combating antibiotic-resistant bacteria Adv Drug Deliv Rev 2022 Aug187114378 https://doi.org/10.1016/j.addr.2022.11437810.1016/j.addr.2022.11437835671882Search in Google Scholar

Choi JH, Lee H, Choi EH. Antimicrobial resistance and molecular analysis of Staphylococcus aureus in staphylococcal scalded skin syndrome among children in Korea. J Korean Med Sci. 2021;36(3):e22. https://doi.org/10.3346/jkms.2021.36.e22 Choi JH Lee H Choi EH Antimicrobial resistance and molecular analysis of Staphylococcus aureus in staphylococcal scalded skin syndrome among children in Korea J Korean Med Sci 2021363e22 https://doi.org/10.3346/jkms.2021.36.e2210.3346/jkms.2021.36.e22781358633463096Search in Google Scholar

EUCAST. Antimicrobial susceptibility testing EUCAST disk diffusion method. Version 8.0 January 2020. Basel (Switzerland): The European Committee on Antimicrobial Susceptibility Testing; 2020 [cited 2022 Apr 8]. Available from https://www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files/Disk_test_documents/2020_manuals/Manual_v_8.0_EUCAST_Disk_Test_2020.pdf EUCAST. Antimicrobial susceptibility testing EUCAST disk diffusion method. Version 8.0 January 2020 Basel (Switzerland) The European Committee on Antimicrobial Susceptibility Testing 2020 [cited 2022 Apr 8]. Available from https://www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files/Disk_test_documents/2020_manuals/Manual_v_8.0_EUCAST_Disk_Test_2020.pdfSearch in Google Scholar

Gagliotti C, Högberg LD, Billström H, Eckmanns T, Giske CG, Heuer OE, Jarlier V, Kahlmeter G, Lo Fo Wong D, Monen J, et al.; EARS-Net study group participants. Staphylococcus aureus bloodstream infections: diverging trends of meticillin-resistant and meticillin-susceptible isolates, EU/EEA, 2005 to 2018. Euro Surveill. 2021 Nov 18;26(46):2002094. https://doi.org/10.2807/1560-7917.ES.2021.26.46.2002094 Gagliotti C Högberg LD Billström H Eckmanns T Giske CG Heuer OE Jarlier V Kahlmeter G Lo Fo Wong D Monen J et al EARS-Net study group participants. Staphylococcus aureus bloodstream infections: diverging trends of meticillin-resistant and meticillin-susceptible isolates, EU/EEA 2005 to 2018. Euro Surveill. 2021 Nov 1826462002094 https://doi.org/10.2807/1560-7917.ES.2021.26.46.200209410.2807/1560-7917.ES.2021.26.46.2002094860340634794536Search in Google Scholar

He S, Deng Q, Liang B, Yu F, Yu X, Guo D, Liu X, Dong H. Suppressing alpha-hemolysin as potential target to screen of flavonoids to combat bacterial coinfection. Molecules. 2021 Dec 14;26(24):7577. https://doi.org/10.3390/molecules26247577 He S Deng Q Liang B Yu F Yu X Guo D Liu X Dong H Suppressing alpha-hemolysin as potential target to screen of flavonoids to combat bacterial coinfection Molecules 2021 Dec 1426247577 https://doi.org/10.3390/molecules2624757710.3390/molecules26247577870938534946657Search in Google Scholar

Horino T, Hori S. Metastatic infection during Staphylococcus aureus bacteremia. J Infect Chemother. 2020 Feb;26(2):162–169. https://doi.org/10.1016/j.jiac.2019.10.003 Horino T Hori S Metastatic infection during Staphylococcus aureus bacteremia J Infect Chemother 2020 Feb262162 169 https://doi.org/10.1016/j.jiac.2019.10.00310.1016/j.jiac.2019.10.00331676266Search in Google Scholar

Jernigan JA, Hatfield KM, Wolford H, Nelson RE, Olubajo B, Reddy SC, McCarthy N, Paul P, McDonald LC, Kallen A, et al. Multidrug- resistant bacterial infections in U.S. hospitalized patients, 2012–2017. N Engl J Med. 2020 Apr 02;382(14):1309–1319. https://doi.org/10.1056/NEJMoa1914433 Jernigan JA Hatfield KM Wolford H Nelson RE Olubajo B Reddy SC McCarthy N Paul P McDonald LC Kallen A et al Multidrug- resistant bacterial infections in U.S hospitalized patients, 2012–2017. N Engl J Med 2020 Apr 02382141309 1319 https://doi.org/10.1056/NEJMoa191443310.1056/NEJMoa191443332242356Search in Google Scholar

Jorgensen SCJ, Lagnf AM, Bhatia S, Singh NB, Shammout LK, Davis SL, Rybak MJ. Diagnostic stewardship: A clinical decision rule for blood cultures in community-onset methicillin-resistant Staphylococcus aureus (MRSA) skin and soft tissue infections. Infect Dis Ther. 2019 Jun;8(2):229–242. https://doi.org/10.1007/s40121-019-0238-1 Jorgensen SCJ Lagnf AM Bhatia S Singh NB Shammout LK Davis SL Rybak MJ Diagnostic stewardship: A clinical decision rule for blood cultures in community-onset methicillin-resistant Staphylococcus aureus (MRSA) skin and soft tissue infections Infect Dis Ther 2019 Jun82229 242 https://doi.org/10.1007/s40121-019-0238-110.1007/s40121-019-0238-1652257730783995Search in Google Scholar

Junnila J, Hirvioja T, Rintala E, Auranen K, Rantakokko-Jalava K, Silvola J, Lindholm L, Gröndahl-Yli-Hannuksela K, Marttila H, Vuopio J. Changing epidemiology of methicillin-resistant Staphylococcus aureus in a low endemicity area – new challenges for MRSA control. Eur J Clin Microbiol Infect Dis. 2020 Dec;39(12):2299–2307. https://doi.org/10.1007/s10096-020-03824-9 Junnila J Hirvioja T Rintala E Auranen K Rantakokko-Jalava K Silvola J Lindholm L Gröndahl-Yli-Hannuksela K Marttila H Vuopio J Changing epidemiology of methicillin-resistant Staphylococcus aureus in a low endemicity area – new challenges for MRSA control Eur J Clin Microbiol Infect Dis 2020 Dec39122299 2307 https://doi.org/10.1007/s10096-020-03824-910.1007/s10096-020-03824-9766980031989375Search in Google Scholar

Kot B, Wierzchowska K, Piechota M, Gruzewska A. Antimicrobial resistance patterns in methicillin-resistant Staphylococcus aureus from patients hospitalized during 2015-2017 in hospitals in Poland. Med Princ Pract. 2020;29(1):61–68. https://doi.org/10.1159/000501788 Kot B Wierzchowska K Piechota M Gruzewska A Antimicrobial resistance patterns in methicillin-resistant Staphylococcus aureus from patients hospitalized during 2015-2017 in hospitals in Poland Med Princ Pract 202029161 68 https://doi.org/10.1159/00050178810.1159/000501788702485831256152Search in Google Scholar

Kourtis AP, Hatfield K, Baggs J, Mu Y, See I, Epson E, Nadle J, Kainer MA, Dumyati G, Petit S, et al.; Emerging Infections Program MRSA author group. Vital Signs: Epidemiology and recent trends in methicillin-resistant and in methicillin- susceptible Staphylococcus aureus bloodstream infections – United States. MMWR Morb Mortal Wkly Rep. 2019 Mar 08;68(9):214–219. https://doi.org/10.15585/mmwr.mm6809e1 Kourtis AP Hatfield K Baggs J Mu Y See I Epson E Nadle J Kainer MA Dumyati G Petit S et al Emerging Infections Program MRSA author group. Vital Signs: Epidemiology and recent trends in methicillin-resistant and in methicillin- susceptible Staphylococcus aureus bloodstream infections – United States MMWR Morb Mortal Wkly Rep 2019 Mar 08689214 219 https://doi.org/10.15585/mmwr.mm6809e110.15585/mmwr.mm6809e1642196730845118Search in Google Scholar

Lebughe M, Phaku P, Niemann S, Mumba D, Peters G, Muyembe-Tamfum JJ, Mellmann A, Strauß L, Schaumburg F. The impact of the Staphylococcus aureus virulome on infection in a developing country: A cohort study. Front Microbiol. 2017 Aug 29;8(AUG):1662. https://doi.org/10.3389/fmicb.2017.01662 Lebughe M Phaku P Niemann S Mumba D Peters G Muyembe-Tamfum JJ Mellmann A Strauß L Schaumburg F The impact of the Staphylococcus aureus virulome on infection in a developing country: A cohort study Front Microbiol 2017 Aug 298AUG1662 https://doi.org/10.3389/fmicb.2017.0166210.3389/fmicb.2017.01662558193428900424Search in Google Scholar

Li X, Huang T, Xu K, Li C, Li Y. Molecular characteristics and virulence gene profiles of Staphylococcus aureus isolates in Hainan, China. BMC Infect Dis. 2019 Dec;19(1):873. https://doi.org/10.1186/s12879-019-4547-5 Li X Huang T Xu K Li C Li Y Molecular characteristics and virulence gene profiles of Staphylococcus aureus isolates in Hainan, China BMC Infect Dis 2019 Dec191873 https://doi.org/10.1186/s12879-019-4547-510.1186/s12879-019-4547-5680558231640587Search in Google Scholar

Li Z, Zhuang H, Wang G, Wang H, Dong Y. Prevalence, predictors, and mortality of bloodstream infections due to methicillin-resistant Staphylococcus aureus in patients with malignancy: Systemic review and meta-analysis. BMC Infect Dis. 2021 Dec;21(1):74. https://doi.org/10.1186/s12879-021-05763-y Li Z Zhuang H Wang G Wang H Dong Y Prevalence, predictors, and mortality of bloodstream infections due to methicillin-resistant Staphylococcus aureus in patients with malignancy: Systemic review and meta-analysis BMC Infect Dis 2021 Dec21174 https://doi.org/10.1186/s12879-021-05763-y10.1186/s12879-021-05763-y780979833446122Search in Google Scholar

Liu B, Sun H, Pan Y, Zhai Y, Cai T, Yuan X, Gao Y, He D, Liu J, Yuan L, et al. Prevalence, resistance pattern, and molecular characterization of Staphylococcus aureus isolates from healthy animals and sick populations in Henan Province, China. Gut Pathog. 2018 Jul 17;10(1):31. https://doi.org/10.1186/s13099-018-0254-9 Liu B Sun H Pan Y Zhai Y Cai T Yuan X Gao Y He D Liu J Yuan L et al Prevalence, resistance pattern, and molecular characterization of Staphylococcus aureus isolates from healthy animals and sick populations in Henan Province, China Gut Pathog 2018 Jul 1710131 https://doi.org/10.1186/s13099-018-0254-910.1186/s13099-018-0254-9604877430026814Search in Google Scholar

Lu H, Zhao L, Si Y, Jian Y, Wang Y, Li T, Dai Y, Huang Q, Ma X, He L, et al. The surge of hypervirulent ST398 MRSA lineage with >higher biofilm-forming ability is a critical threat to clinics. Front Microbiol. 2021 Mar 4;12(March):636788. https://doi.org/10.3389/fmicb.2021.636788 Lu H Zhao L Si Y Jian Y Wang Y Li T Dai Y Huang Q Ma X He L et al The surge of hypervirulent ST398 MRSA lineage with >higher biofilm-forming ability is a critical threat to clinics Front Microbiol 2021 Mar 412March636788 https://doi.org/10.3389/fmicb.2021.63678810.3389/fmicb.2021.636788796981533746929Search in Google Scholar

Maalej SM, Trabelsi JJ, Claude-alexandre G, Boutiba I, Mastouri M, Besbes S, Barguellil F, Laurent F, Hammami A. Antimicrobial susceptibility and molecular epidemiology of methicillin-resistant Staphylococcus aureus in Tunisia: Results of a multicenter study. J Infect Dis Epidemiol. 2019 Mar 11;5(2):071. https://doi.org/10.23937/2474-3658/1510071 Maalej SM Trabelsi JJ Claude-alexandre G Boutiba I Mastouri M Besbes S Barguellil F Laurent F Hammami A Antimicrobial susceptibility and molecular epidemiology of methicillin-resistant Staphylococcus aureus in Tunisia: Results of a multicenter study J Infect Dis Epidemiol 2019 Mar 1152071 https://doi.org/10.23937/2474-3658/151007110.23937/2474-3658/1510071Search in Google Scholar

Mariutti RB, Tartaglia NR, Seyffert N, de Paula Castro T, Arni RK, Azevedo VA, Le Loir Y, Nishifuji K. Exfoliative toxins of Staphylococcus aureus. In: Enany S, Alexander LEC, editors. The rise of virulence and antibiotic resistance in Staphylococcus aureus. London (UK): IntechOpen; 2017. https://doi.org/10.5772/66528 Mariutti RB Tartaglia NR Seyffert N de Paula Castro T Arni RK Azevedo VA Le Loir Y Nishifuji K Exfoliative toxins of Staphylococcus aureus In Enany S Alexander LEC editors The rise of virulence and antibiotic resistance in Staphylococcus aureus London (UK) IntechOpen 2017 https://doi.org/10.5772/6652810.5772/66528Search in Google Scholar

Mohseni M, Rafiei F, Ghaemi EA. High frequency of exfoliative toxin genes among Staphylococcus aureus isolated from clinical specimens in the north of Iran: Alarm for the health of individuals under risk. Iran J Microbiol. 2018 Jun; 10(3):158–165. Mohseni M Rafiei F Ghaemi EA High frequency of exfoliative toxin genes among Staphylococcus aureus isolated from clinical specimens in the north of Iran: Alarm for the health of individuals under risk Iran J Microbiol 2018 Jun 103158 165Search in Google Scholar

Naorem RS, Pangabam BD, Bora SS, Goswami G, Barooah M, Hazarika DJ, Fekete C. Identification of putative vaccine and drug targets against the methicillin-resistant Staphylococcus aureus by reverse vaccinology and subtractive genomics approaches. Molecules. 2022 Mar 24;27(7):2083. https://doi.org/10.3390/molecules27072083 Naorem RS Pangabam BD Bora SS Goswami G Barooah M Hazarika DJ Fekete C Identification of putative vaccine and drug targets against the methicillin-resistant Staphylococcus aureus by reverse vaccinology and subtractive genomics approaches Molecules 2022 Mar 242772083 https://doi.org/10.3390/molecules2707208310.3390/molecules27072083900051135408485Search in Google Scholar

Nisar S, Kirkpatrick LD, Shupp JW. Bacterial virulence factors and their contribution to pathophysiology after thermal injury. Surg Infect (Larchmt). 2021 Feb;22(1):69–76. https://doi.org/10.1089/sur.2020.188 Nisar S Kirkpatrick LD Shupp JW Bacterial virulence factors and their contribution to pathophysiology after thermal injury Surg Infect (Larchmt) 2021 Feb22169 76 https://doi.org/10.1089/sur.2020.18810.1089/sur.2020.18832735479Search in Google Scholar

Okwu MU, Olley M, Akpoka AO, Izevbuwa OE. Methicillin-resistant Staphylococcus aureus (MRSA) and anti-MRSA activities of extracts of some medicinal plants: A brief review. AIMS Microbiol. 2019 Apr 15;5(2):117–137. https://doi.org/10.3934/microbiol.2019.2.117 Okwu MU Olley M Akpoka AO Izevbuwa OE Methicillin-resistant Staphylococcus aureus (MRSA) and anti-MRSA activities of extracts of some medicinal plants: A brief review AIMS Microbiol 2019 Apr 1552117 137 https://doi.org/10.3934/microbiol.2019.2.11710.3934/microbiol.2019.2.117664290731384707Search in Google Scholar

Pannewick B, Baier C, Schwab F, Vonberg RP. Infection control measures in nosocomial MRSA outbreaks – Results of a systematic analysis. PLoS One. 2021 Apr 7;16(4):e0249837. https://doi.org/10.1371/journal.pone.0249837 Pannewick B Baier C Schwab F Vonberg RP Infection control measures in nosocomial MRSA outbreaks – Results of a systematic analysis PLoS One 2021 Apr 7164e0249837 https://doi.org/10.1371/journal.pone.024983710.1371/journal.pone.0249837802605633826678Search in Google Scholar

Papadimitriou-Olivgeris M, Drougka E, Fligou F, Dodou V, Kolonitsiou F, Filos KS, Anastassiou ED, Petinaki E, Marangos M, Spiliopoulou I. Spread of Tst-positive Staphylococcus aureus strains belonging to ST30 clone among patients and healthcare workers in two intensive care units. Toxins (Basel). 2017 Sep 4;9(9):270. https://doi.org/10.3390/TOXINS9090270 Papadimitriou-Olivgeris M Drougka E Fligou F Dodou V Kolonitsiou F Filos KS Anastassiou ED Petinaki E Marangos M Spiliopoulou I Spread of Tst-positive Staphylococcus aureus strains belonging to ST30 clone among patients and healthcare workers in two intensive care units Toxins (Basel) 2017 Sep 499270 https://doi.org/10.3390/TOXINS909027010.3390/toxins9090270561820328869541Search in Google Scholar

Park KH, Greenwood-Quaintance KE, Cunningham SA, Raja-gopalan G, Chia N, Jeraldo PR, Mandrekar J, Patel R. Lack of correlation of virulence gene profiles of Staphylococcus aureus bacteremia isolates with mortality. Microb Pathog. 2019 Aug;133:103543. https://doi.org/10.1016/j.micpath.2019.103543 Park KH Greenwood-Quaintance KE Cunningham SA Raja-gopalan G Chia N Jeraldo PR Mandrekar J Patel R Lack of correlation of virulence gene profiles of Staphylococcus aureus bacteremia isolates with mortality Microb Pathog 2019 Aug133103543 https://doi.org/10.1016/j.micpath.2019.10354310.1016/j.micpath.2019.10354331102653Search in Google Scholar

Peterson JC, Durkee H, Miller D, Maestre-Mesa J, Arboleda A, Aguilar MC, Relhan N, Flynn HW Jr, Amescua G, Parel JM, et al. Molecular epidemiology and resistance profiles among healthcare-and community-associated Staphylococcus aureus keratitis isolates. Infect Drug Resist. 2019 Apr;12:831–843. https://doi.org/10.2147/IDR.S190245 Peterson JC Durkee H Miller D Maestre-Mesa J Arboleda A Aguilar MC Relhan N Flynn HW Jr Amescua G Parel JM et al Molecular epidemiology and resistance profiles among healthcare-and community-associated Staphylococcus aureus keratitis isolates Infect Drug Resist 2019 Apr12831 843 https://doi.org/10.2147/IDR.S19024510.2147/IDR.S190245646946931043797Search in Google Scholar

Pomorska-Wesołowska M, Różańska A, Natkaniec J, Gryglewska B, Szczypta A, Dzikowska M, Chmielarczyk A, Wójkowska-Mach J. Longevity and gender as the risk factors of methicillin-resistant Staphylococcus aureus infections in southern Poland. BMC Geriatr. 2017 Dec;17(1):51. https://doi.org/10.1186/s12877-017-0442-3 Pomorska-Wesołowska M Różańska A Natkaniec J Gryglewska B Szczypta A Dzikowska M Chmielarczyk A Wójkowska-Mach J Longevity and gender as the risk factors of methicillin-resistant Staphylococcus aureus infections in southern Poland BMC Geriatr 2017 Dec17151 https://doi.org/10.1186/s12877-017-0442-310.1186/s12877-017-0442-3530324328187785Search in Google Scholar

Rahman MM, Amin KB, Rahman SMM, Khair A, Rahman M, Hossain A, Rahman AKMA, Parvez MS, Miura N, Alam MM. Investigation of methicillin-resistant Staphylococcus aureus among clinical isolates from humans and animals by culture methods and multiplex PCR. BMC Vet Res. 2018 Oct 3;14(1):300. https://doi.org/10.1186/s12917-018-1611-0 Rahman MM Amin KB Rahman SMM Khair A Rahman M Hossain A Rahman AKMA Parvez MS Miura N Alam MM Investigation of methicillin-resistant Staphylococcus aureus among clinical isolates from humans and animals by culture methods and multiplex PCR BMC Vet Res 2018 Oct 3141300 https://doi.org/10.1186/s12917-018-1611-010.1186/s12917-018-1611-0616906430285752Search in Google Scholar

Rasheed NA, Hussein NR. Characterization of different virulent factors in methicillin-resistant Staphylococcus aureus isolates recovered from Iraqis and Syrian refugees in Duhok city, Iraq. PLoS One. 2020 Aug 17;15(8):e0237714. https://doi.org/10.1371/journal.pone.0237714 Rasheed NA Hussein NR Characterization of different virulent factors in methicillin-resistant Staphylococcus aureus isolates recovered from Iraqis and Syrian refugees in Duhok city, Iraq PLoS One 2020 Aug 17158e0237714 https://doi.org/10.1371/journal.pone.023771410.1371/journal.pone.0237714743075332804961Search in Google Scholar

Schulz M, Calabrese S, Hausladen F, Wurm H, Drossart D, Stock K, Sobieraj AM, Eichenseher F, Loessner MJ, Schmelcher M, et al. Point-of-care testing system for digital single cell detection of MRSA directly from nasal swabs. Lab Chip. 2020 Jul 14;20(14):2549–2561. https://doi.org/10.1039/D0LC00294A Schulz M Calabrese S Hausladen F Wurm H Drossart D Stock K Sobieraj AM Eichenseher F Loessner MJ Schmelcher M et al Point-of-care testing system for digital single cell detection of MRSA directly from nasal swabs Lab Chip 2020 Jul 1420142549 2561 https://doi.org/10.1039/D0LC00294A10.1039/D0LC00294A32568322Search in Google Scholar

Shahini Shams-Abadi M, Halaji M, Hoseini-Alfatemi SM, Gholipour A, Mojtahedi A, Sedigh Ebrahim-Saraie H. Epidemiology of toxic shock syndrome toxin-1 harboring Staphylococcus aureus obtained from clinical samples in Iran: A systematic review and meta-analysis. Ann Ig. 2018 Sep–Oct;30(5):391–400. https://doi.org/10.7416/ai.2018.2239 Shahini Shams-Abadi M Halaji M Hoseini-Alfatemi SM Gholipour A Mojtahedi A Sedigh Ebrahim-Saraie H Epidemiology of toxic shock syndrome toxin-1 harboring Staphylococcus aureus obtained from clinical samples in Iran: A systematic review and meta-analysis Ann Ig 2018 Sep–Oct305391 400 https://doi.org/10.7416/ai.2018.2239Search in Google Scholar

Shettigar K, Murali TS. Virulence factors and clonal diversity of Staphylococcus aureus in colonization and wound infection with emphasis on diabetic foot infection. Eur J Clin Microbiol Infect Dis. 2020 Dec;39(12):2235–2246. https://doi.org/10.1007/s10096-020-03984-8 Shettigar K Murali TS Virulence factors and clonal diversity of Staphylococcus aureus in colonization and wound infection with emphasis on diabetic foot infection Eur J Clin Microbiol Infect Dis 2020 Dec39122235 2246 https://doi.org/10.1007/s10096-020-03984-810.1007/s10096-020-03984-8766977932683595Search in Google Scholar

Thorlacius-Ussing L, Sandholdt H, Larsen AR, Petersen A, Benfield T. Age-dependent increase in incidence of Staphylococcus aureus bacteremia, Denmark, 2008–2015. Emerg Infect Dis. 2019 May;25(5):875–882. https://doi.org/10.3201/eid2505.181733 Thorlacius-Ussing L Sandholdt H Larsen AR Petersen A Benfield T Age-dependent increase in incidence of Staphylococcus aureus bacteremia, Denmark, 2008–2015 Emerg Infect Dis 2019 May255875 882 https://doi.org/10.3201/eid2505.18173310.3201/eid2505.181733647819631002300Search in Google Scholar

Tong SYC, Davis JS, Eichenberger E, Holland TL, Fowler VG Jr. Staphylococcus aureus infections: epidemiology, pathophysiology, clinical manifestations, and management. Clin Microbiol Rev. 2015 Jul;28(3):603–661. https://doi.org/10.1128/CMR.00134-14 Tong SYC Davis JS Eichenberger E Holland TL Fowler VG Jr Staphylococcus aureus infections: epidemiology, pathophysiology, clinical manifestations, and management Clin Microbiol Rev 2015 Jul283603 661 https://doi.org/10.1128/CMR.00134-1410.1128/CMR.00134-14445139526016486Search in Google Scholar

Tsuzuki S, Matsunaga N, Yahara K, Shibayama K, Sugai M, Ohmagari N. Disease burden of bloodstream infections caused by antimicrobial-resistant bacteria: A population-level study, Japan, 2015–2018. Int J Infect Dis. 2021 Jul;108:119–124. https://doi.org/10.1016/j.ijid.2021.05.018 Tsuzuki S Matsunaga N Yahara K Shibayama K Sugai M Ohmagari N Disease burden of bloodstream infections caused by antimicrobial-resistant bacteria: A population-level study, Japan, 2015–2018 Int J Infect Dis 2021 Jul108119 124 https://doi.org/10.1016/j.ijid.2021.05.01810.1016/j.ijid.2021.05.01833992765Search in Google Scholar

Tuffs SW, Herfst CA, Baroja ML, Podskalniy VA, DeJong EN, Coleman CEM, McCormick JK. Regulation of toxic shock syndrome toxin‐1 by the accessory gene regulator in Staphylococcus aureus is mediated by the repressor of toxins. Mol Microbiol. 2019 Oct;112(4):1163–1177. https://doi.org/10.1111/mmi.14353 Tuffs SW Herfst CA Baroja ML Podskalniy VA DeJong EN Coleman CEM McCormick JK Regulation of toxic shock syndrome toxin‐1 by the accessory gene regulator in Staphylococcus aureus is mediated by the repressor of toxins Mol Microbiol 2019 Oct11241163 1177 https://doi.org/10.1111/mmi.1435310.1111/mmi.1435331321813Search in Google Scholar

Turner NA, Sharma-Kuinkel BK, Maskarinec SA, Eichenberger EM, Shah PP, Carugati M, Holland TL, Fowler VG Jr. Methicillin-resistant Staphylococcus aureus: An overview of basic and clinical research. Nat Rev Microbiol. 2019 Apr;17(4):203–218. https://doi.org/10.1038/s41579-018-0147-4 Turner NA Sharma-Kuinkel BK Maskarinec SA Eichenberger EM Shah PP Carugati M Holland TL Fowler VG Jr Methicillin-resistant Staphylococcus aureus: An overview of basic and clinical research Nat Rev Microbiol 2019 Apr174203 218 https://doi.org/10.1038/s41579-018-0147-410.1038/s41579-018-0147-4693988930737488Search in Google Scholar

Uehara Y. Current status of staphylococcal cassette chromosome mec (SCCmec). Antibiotics (Basel). 2022 Jan 11;11(1):86. https://doi.org/10.3390/antibiotics11010086 Uehara Y Current status of staphylococcal cassette chromosome mec (SCCmec) Antibiotics (Basel) 2022 Jan 1111186 https://doi.org/10.3390/antibiotics1101008610.3390/antibiotics11010086877272635052963Search in Google Scholar

Urushibara N, Aung MS, Kawaguchiya M, Kobayashi N. Novel staphylococcal cassette chromosome mec (SCCmec) type XIV (5A) and a truncated SCCmec element in SCC composite islands carrying speG in ST5 MRSA in Japan. J Antimicrob Chemother. 2020 Jan 1;75(1):46–50. https://doi.org/10.1093/jac/dkz406 Urushibara N Aung MS Kawaguchiya M Kobayashi N Novel staphylococcal cassette chromosome mec (SCCmec) type XIV (5A) and a truncated SCCmec element in SCC composite islands carrying speG in ST5 MRSA in Japan J Antimicrob Chemother 2020 Jan 175146 50 https://doi.org/10.1093/jac/dkz40610.1093/jac/dkz40631617906Search in Google Scholar

Zhao H, Xu S, Yang H, He C, Xu X, Hu F, Shu W, Gong F, Zhang C, Liu Q. Molecular typing and variations in amount of tst gene expression of TSST-1-producing clinical Staphylococcus aureus isolates. Front Microbiol. 2019 Jun 19;10(JUN):1388. https://doi.org/10.3389/fmicb.2019.01388 Zhao H Xu S Yang H He C Xu X Hu F Shu W Gong F Zhang C Liu Q Molecular typing and variations in amount of tst gene expression of TSST-1-producing clinical Staphylococcus aureus isolates Front Microbiol 2019 Jun 1910JUN1388 https://doi.org/10.3389/fmicb.2019.0138810.3389/fmicb.2019.01388659435631275293Search in Google Scholar

Zhou W, Wu R, Duraiswamy S, Wang W, Zhu L, Wang Z. Development of microfluidic cartridge for culture-free detection of Staphylococcus aureus in blood. J Micromech Microeng. 2021 May 01; 31(5):055012. https://doi.org/10.1088/1361-6439/abf32f Zhou W Wu R Duraiswamy S Wang W Zhu L Wang Z Development of microfluidic cartridge for culture-free detection of Staphylococcus aureus in blood J Micromech Microeng 2021 May 01 315055012 https://doi.org/10.1088/1361-6439/abf32f10.1088/1361-6439/abf32fSearch in Google Scholar

Artículos recomendados de Trend MD

Planifique su conferencia remota con Sciendo