1. bookVolume 1 (2021): Issue 2 (September 2021)
Journal Details
License
Format
Journal
eISSN
2719-3500
First Published
30 Jun 2021
Publication timeframe
4 times per year
Languages
English
access type Open Access

Analysis of dapagliflozin-induced expression profile of long noncoding RNAs in proximal tubular epithelial cells of diabetic kidney disease

Published Online: 16 Jun 2022
Volume & Issue: Volume 1 (2021) - Issue 2 (September 2021)
Page range: 77 - 89
Received: 15 Oct 2020
Accepted: 17 Feb 2022
Journal Details
License
Format
Journal
eISSN
2719-3500
First Published
30 Jun 2021
Publication timeframe
4 times per year
Languages
English
Abstract Background

Accumulating evidence indicates that long noncoding RNAs (lncRNAs) play an important role in diabetic kidney disease (DKD). Dapagliflozin (DAPA), a sodium-glucose cotransporter 2 (SGLT2) inhibitor, exerts protective effects against DKD, but the underlying mechanism remains unclear.

Methods

In this study, we performed RNA microarray analysis to investigate differentially expressed lncRNAs and mRNAs in human proximal tubular epithelial cells (HK-2 cells) cultured with normal glucose (Ng), high glucose (Hg), and Hg plus DAPA, and conducted bioinformatic analyses to investigate their functions.

Results

Compared with the Ng group, 6761 lncRNAs and 3162 mRNAs were differentially expressed in the Hg group. Expression levels of 714 and 259 lncRNAs were up- and down-regulated, respectively, whereas those of 138 and 127 mRNAs were up- and down-regulated, respectively, after DAPA treatment (fold change ≥2, P < 0.05). Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses were conducted to assess the biological functions of lncRNAs and potential target genes. According to GO analysis, dysregulated mRNAs were primarily enriched in the cell cycle, whereas DAPA-induced mRNAs were enriched in collagen biosynthesis and regulation of programmed cell death. Type I diabetes mellitus and cell cycle signaling were the main KEGG pathways in the Hg group. However, cancer and signal transduction pathways were related to DAPA treatment.

Conclusions

Finally, we established protein–protein interaction (PPI) networks, as well as lncRNA–mRNA and lncRNA–miRNA–mRNA networks, and identified five potentially important lncRNAs whose expression levels were altered by DAPA treatment. Our findings suggest that lncRNAs are potential targets for DKD treatment.

Keywords

Introduction

Diabetic kidney disease (DKD) is a microvascular complication of diabetes mellitus and is the main cause of end-stage renal disease [1]. Accumulating evidence indicates that tubular injury is a key factor in renal dysfunction progression. The high glucose (Hg) environment induces various physiological and structural abnormalities in renal tubules, including renal tubular reabsorption imbalance, and tubular epithelial cell proliferation and hypertrophy, aging, apoptosis, and renal tubular interstitial fibrosis, which can induce glomerular injury and eventually progress to end-stage renal disease [2,3,4,5]. Thus, the discovery of novel therapies for DKD has drawn increasing attention in the last years.

Dapagliflozin (DAPA) is a selective inhibitor of sodium–glucose cotransporter 2 (SGLT2). It belongs to a novel class of agents for the treatment of type 2 diabetes, since it can effectively block glucose absorption by the proximal tubule as well as increase the excretion of glucose through urine, thereby reducing blood glucose levels [6]. In addition, its hypoglycemic effect is independent of islet function and insulin sensitivity [7]. Several studies have shown that DAPA inhibits the expression of SGLT2 in renal tubules and causes renal vascular remodeling, thereby exerting a protective effect on the kidneys [8].

Long noncoding RNAs (lncRNAs) are transcripts of >200 nucleotides (nt) with limited protein-encoding potential [9]. LncRNAs participate in various of biological processes, such as the regulation of cell proliferation, apoptosis, cellular differentiation, and epigenetic modifications [10,11,12,13]. Moreover, lncRNAs are reportedly involved in the occurrence and development of DKD. For example, the lncRNA plasmacytoma variant translocation 1 (PVT1) induces the accumulation of extramesenchymal matrix in glomerulus in diabetic rats [14], and lncRNA-Gm4419 promotes fibrosis and proliferation of mesangial cells through NF-κB/NLRP3 inflammatory pathway [15]. However, the exact role of lncRNAs in mediating the effects of DAPA treatment on DKD, especially on the renal tubules, remains unclear.

Here, we investigated the effects of DAPA treatment on the physiological processes of human proximal tubular epithelial cells (HK-2 cells). We performed RNA microarray to characterize the expression profiles of lncRNAs and messenger RNA (mRNAs) in HK-2 cells cultured with normal glucose (Ng), Hg, and Hg plus DAPA. Further, we performed Gene Ontology (GO) terms and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses, and comprehensively delineated the functional landscape of the coding–noncoding co-expression (CNC) and competing endogenous RNA (ceRNA) networks for the first time. Collectively, our study lays a foundation for further exploration of DKD pathogenesis and provides new insights into the mechanisms of DAPA protecting DKD.

Materials and Methods
Cell culture

HK-2 cells were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). HK-2 cells were cultured in DMEM (Hyclone, Los Angeles, CA, USA) supplemented with 10% fetal bovine serum (Gibco, Thermo Fisher, Waltham, MA, USA), 100 U/mL penicillin, and 0.1 mg/mL streptomycin at 37°C in a humidified environment supplemented with 5% CO2. HK-2 cells were cultured with Ng (5.6 mmol/L) and Hg (30 mmol/L) for 24 h, and then were cultured with Ng, Hg, and Hg plus 2.5 μmol/L DAPA (DAPA, MCE, Shanghai, China) or 10 μmol/L canagliflozin (MCE, Shanghai, China) for 48 h.

Quantitative real-time polymerase chain reaction

Total RNA was extracted from HK-2 cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and reverse-transcribed in 20 μL reaction volume using PrimerScript RT Master Mix and random primers according to the manufacturer's protocol (Sangon Biotech, Shanghai, China). DNA amplification was performed on a 7500 Fast Real-Time PCR System (Quant Studio 5, Thermo Fisher, MA, USA). The sequences of the primers used for Real Time Quantitative Polymerase Chain Reaction (RT-qPCR) are listed in Table 1. The expression levels of lncRNAs were normalized to those of GAPDH and calculated using the 2−ΔΔCt method.

Sequence of the primers used for qRT-PCR

lncRNA Forward sequence (5′–3′) Reverse sequence (5′–3′)
NR_027051 AGGTGGTCAGGATGGAGTTGTAGG AAGCGGCTCTCGGTGGACTAC
ENST00000606424 TCCTGATGAAGTGCCAACTGAAGC ACGCAAAAGAATCCATCCCACACC
NR_047558 CGCATCCAGCCATCAACTGACTC AGAGGTGGTGACTGAGGTCGTAAG
ENST00000605056 CCTGAGTGCTGAGGAACAGTGAAC CTGGAGGTGAGGCTGGTGAGG
uc031qjg.1 GGGAAGCAAGGTTCGCCATCC AGAGCAGACAGCAGTGAGAGGAG
ENST00000505796 ACAAGGATCTGAGGAATGTGGC AACTGTATGGGCGAGGCAGA
Microarray analysis

Total RNA was extracted from HK-2 cells and RNA quantity and quality were determined using NanoDrop 2000 (Thermo Scientific, Shanghai, China). Cell transcriptome was analyzed using the Human LncRNA Microarray V4.0, which was designed for global profiling of human lncRNAs and mRNAs. All microarray analyses were performed by KangChen Bio-tech (Shanghai, China). Sample labeling and array hybridization were performed according to the Agilent One-Color Microarray-Based Gene Expression Analysis protocol (Agilent, Technology, Palo Alto, CA, USA).

Differential lncRNA and mRNA expression analyses

Agilent Feature Extraction software (version 11.0.1.1) was used to analyze the array images. Quantile normalization and subsequent data processing were performed using the GeneSpring GX v11.5.1 software package (Agilent Technologies). Differentially expressed lncRNAs and mRNAs among the Ng, Hg, and DAPA groups were identified using scatter plots and volcano plots using the following criteria: fold change ≤2 and P < 0.05.

GO and KEGG pathway analysis

Gene ontology term enrichments were performed to explore the functions of the differentially expressed mRNAs using the online database DAVID (http://david.abcc.ncifcrf.gov/) [16]. KEGG pathway analyses were performed to further explore the functions of the differentially expressed mRNAs according to DAVID (http://david.abcc.ncifcrf.gov/). All terms and pathways were considered significant with an enrichment score of >2.0 and P < 0.05.

Protein–protein interaction (PPI) network analysis

To construct the PPI network, we selected ten mRNAs that were significantly differentially expressed between the Ng and Hg groups, Hg and DAPA groups, using the Search Tool for the Retrieval of Interacting Genes (STRING, http://string.embl.de/) [17]. The cut-off criteria based on interaction score was a combined score of ≥0.9 (0.9 indicates the highest confidence). Subsequently, KEGG pathway analysis was performed using the DAVID online database (http://david.abcc.ncifcrf.gov/).

lncRNA–mRNA and lncRNA–miRNA–mRNA co-expression (CE) networks

The lncRNA–mRNA CE network was built using LncTar database (http://www.cuilab.cn/lnctar) [18] and expression correlations between them were measured using Spearman correlation coefficient (threshold criteria was set at Spearman correlation coefficient R > 0.8, either positive or negative). Statistical significance was set at P < 0.05. Eighteen lncRNAs were selected to generate different networks using the Cytoscape software [19].

The lncRNA–miRNA–mRNA CE network was constructed based on the correlation between the lncRNAs and miRNAs. The miRNA-binding sites were predicted using miRcode (http://www.mircode.org/) and miRanda (http://www.microrna.org/), and the miRNA–mRNA interactions were predicted using TargetScan (http://www.targetscan.org/). Based on the established CE data, lncRNA–miRNA interaction networks were mapped using Cytoscape software.

Statistical analysis

All values are expressed as mean ± standard deviation (SD) derived from at least three experiments, with similar results. Student t-test and one-way analysis of variance were performed to determine the statistical significance of differences between groups. All statistical analyses were performed using GraphPad Prism 6.0. Statistical significance was set at P < 0.05.

Results
Differentially expressed lncRNAs and mRNAs in HK-2 cells cultured in Ng, Hg, and Hg plus DAPA

The microarray probes detected thousands of transcripts in HK-2 cells cultured with Ng, Hg, and DAPA. Scatter and volcano plots were generated to assess the variation in the expression level of lncRNAs and mRNAs between the Ng, Hg, and DAPA groups (Figure 1). A total of 7734 lncRNAs and 3427 mRNAs were identified. Among them, expression levels of 3656 and 3105 lncRNAs were up- and down-regulated, respectively, in the Hg group compared to those of Ng group, and expression levels of 1106 and 2056 mRNAs were up- and down-regulated (fold change ≥2.0, P < 0.05). Meanwhile, expression levels of 714 and 259 lncRNAs were up- and down-regulated, and those of 138 and 127 mRNAs were up- and down-regulated in the DAPA group compared to the Hg group, suggesting that these lncRNAs and mRNAs may participate in the biological processes of HK-2 cells. The values representing expression of the ten most strongly up-regulated and down-regulated lncRNAs induced by Hg with or without DAPA treatment are presented in Tables 2 and 3, respectively.

Differentially expressed lncRNAs and mRNAs in HK-2 cells cultured in in Ng, Hg, and Hg plus DAPA. (A, B) Scatter plots of the differentially expressed lncRNAs between Ng and Hg groups (A); DAPA and Hg groups (B). (C, D) Scatter plots of the differentially expressed mRNAs between Ng and Hg groups (C); DAPA and Hg groups (D). (E, F) Volcano plots of the differentially expressed lncRNAs between Ng and Hg groups (E); DAPA and Hg groups (F). (G, H) Volcano plots of the differentially expressed mRNAs between Ng and Hg groups (G); DAPA and Hg groups (H). (Fold-changes ≥2.0 and P < 0.05). DAPA, dapagliflozin; Hg, high glucose; Ng, normal glucose.

Representative overlapped differentially expressed lncRNAs (Top 10, Hg vs. Ng)

lncRNA ID lncRNA regulation lncRNA ID lncRNA regulation
T379873 Up ENST00000607068 Down
ENST00000514869 Up ENST00000501143 Down
T036399 Up T206052 Down
ENST00000608672 Up ENST00000608721 Down
ENST00000594512 Up ENST00000577848 Down
NR_102703 Up ENST00000515422 Down
T251871 Up ENST00000605281 Down
T252353 Up T378692 Down
uc.350+ Up ENST00000572811 Down
T136710 Up NR_047116 Down

Ng, normal glucose; Hg, high glucose.

Representative overlapped differentially expressed lncRNAs (Top 10, DAPA vs. Hg)

lncRNA ID lncRNA regulation lncRNA ID lncRNA regulation
T292663 Up T008148 Down
T152286 Up T127088 Down
ENST00000608684 Up T221412 Down
ENST00000505796 Up NR_047558 Down
NR_027242 Up T347175 Down
NR_027051 Up GSE61474_TCONS_00118477 Down
ENST00000606424 Up T268044 Down
ENST00000608517 Up ENST00000596971 Down
ENST00000441312 Up ENST00000605056 Down
ENST00000607068 Up uc031qjg.1 Down

Hg, high glucose; DAPA, dapagliflozin.

Signature lncRNA expression in the Hg and Hg + DAPA groups

The previous results suggested that DAPA plays a key role in the physiological function of HK-2 cells, highlighting the need to investigate the characteristics of DAPA-induced lncRNAs including their source, classification, length distribution, and chromosome distribution. The results suggested that natural antisense lncRNAs represented the largest category (26%) of all the differentially expressed lncRNAs, followed by intronic antisense lncRNAs (23%) and bidirectional lncRNAs (16%) (Figure 2A). We also found that most lncRNAs were derived from RNA-sequence sources (Figure 2B). These lncRNAs were 401–800 nt and 1201–1600 nt long (Figure 2C) and chromosome distribution analysis revealed that DAPA-associated lncRNAs were located on different chromosomes (Figure 2D).

Signature lncRNA expression in the Hg and Hg + DAPA groups. (A) The numbers of lncRNAs from various databases. (B) The classification of lncRNAs. (C) The distribution of differentially expressed lncRNAs based on the length of nuclear acids. (D) The number of reads mapped to each chromosome. DAPA, dapagliflozin; Hg, high glucose.

Gene Ontology (GO) and KEGG pathway enrichment analysis

Although lncRNAs do not encode proteins, they regulate the expression of neighboring and overlapping protein-coding genes, thereby performing their functions. To investigate the functions of the differentially expressed mRNAs in HK-2 cells, GO terms enrichment analysis was performed. The results showed that the mRNAs whose expression levels were up-regulated between the Ng and Hg group were associated with biological processes such as anatomical structure development, development process, single-organism developmental process, cell surface receptor signaling pathway, and cell differentiation (Figure 3A). The transcripts with down-regulated expression levels were mainly associated with the cell cycle, mitotic cell cycle, and chromosome organization (Figure 3B). For the Hg and DAPA groups, the mRNAs with up-regulated expression were mainly associated with the regulation of collagen biosynthetic process, regulation of collagen metabolic processes, and response to hepatocyte growth factor (Figure 3C); whereas mRNAs with down-regulated expression levels were mainly involved in the regulation of apoptosis, apoptotic signaling pathway, positive regulation of response to stimulus, extrinsic apoptotic signaling pathway, and vasculature development (Figure 3D). We also performed KEGG pathway enrichment analysis and found ten pathways associated with up-regulated mRNAs and ten pathways related to down-regulated mRNAs in the Hg group compared with the Ng group. The up-regulated mRNAs were mainly related to the type I diabetes mellitus signaling (Figure 3E), while the down-regulated mRNAs mainly enriched the cell cycle signaling (Figure 3F). Significantly, KEGG pathway analyses suggested that the differentially expressed genes between the Hg and DAPA groups were related to transcriptional dysregulation observed in cancer, DNA replication, and the Notch signaling pathway (Figure 3G). Genes with down-regulated expression were enriched in the pathways related to central carbon metabolism in cancer, alanine, aspartate, and glutamate metabolism, cytokine receptor interaction, ErbB signaling pathway, HIF-1: hypoxia inducible factor-1 (HIF-1) signaling pathway, MAPK: mitogen-activated protein kinase (MAPK) signaling pathway, p53 signaling pathway, P13K-Akt signaling pathway, and focal adhesion (Figure 3H). Taken together, these results suggest that the impaired expression of genes and lncRNAs leads to dysregulation of pathways that might be strongly related to diabetes mellitus or its complications, and provide key clues to explore the relationship between DKD and DAPA treatment in the future.

GO and KEGG pathway enrichment analysis of differentially expressed lncRNA corresponding genes. (A, B) GO annotations for biological process category of the up-regulated (A) and down-regulated (B) genes between the Ng and Hg groups. (C, D) GO annotations for biological process category of the up-regulated (C) and down-regulated (D) genes between the DAPA and Hg groups. (E, F) KEGG analysis of the up-regulated (E) and down-regulated genes (F) between the Ng and Hg groups. (G, H) KEGG analysis of the up-regulated (G) and down-regulated genes (H) between the DAPA and Hg groups. Enrichment score values were calculated as −log10 (P-Values). DAPA, dapagliflozin; GO, gene ontology; Hg, high glucose; KEGG, Kyoto Encyclopedia of Genes and Genomes; Ng, normal glucose.

PPI network construction and KEGG pathway analysis

To further investigate the cellular processes related to the differentially expressed genes between the Ng, Hg, and DAPA groups, the PPI networks of the encoded proteins were generated using STRING database. The interaction score (≥0.9) of the differentially expressed genes was used to evaluate the protein interactions, and the interacting proteins were subjected to KEGG pathway enrichment analysis. We established the PPI network (Figure 4A) between the Hg and Ng groups and found that proteins encoded by differentially expressed genes were mainly involved in metabolic pathways and peroxisome proliferator-activated receptor (PPAR) signaling pathway (Figure 4B). We also constructed the PPI network (Figure 4C) for the proteins encoded by differentially expressed genes between the DAPA and Hg groups and found that cell cycle and cancer pathways play an important role in HK-2 cells subjected to DAPA treatment (Figure 4D). Overall, these data demonstrated that most of the differentially expressed genes were mainly associated with metabolism and cell cycle signaling.

PPI network construction and KEGG pathway analysis. (A, B) PPI network (A) and KEGG pathway analysis (B) for differentially expressed mRNA between the Ng and Hg groups. (C, D) PPI network (C) and KEGG pathway analysis (D) for differentially expressed mRNA between the Hg and DAPA groups. Each protein is presented as a network node, and the edges represent meaningful protein–protein associations. CDB, curated data bases; CE, co-expression; DAPA: dapagliflozin; ED, experimentally determined; GC-O, gene co-occurrence; GF, gene fusions; GN, gene neighborhood; Hg: high glucose; KEGG, Kyoto Encyclopedia of Genes and Genomes; Ng: normal glucose; PH, protein homology; PPI, protein–protein interaction; TM, text mining.

CE of lncRNA-mRNA pairs and their functional prediction

To date, the functions of most lncRNAs have not been elucidated, and the prediction of most lncRNAs functions is partly based on the annotations of co-expressed mRNAs. Based on the results of the previous analyses, we selected six lncRNAs that were significantly differentially expressed in the Ng, Hg, and DAPA groups to build CNC networks according to the degree of correlation. The networks indicated that one lncRNA could regulate multiple genes in different ways, and that one gene could also be regulated by multiple lncRNAs (Figure 5A, C). The differentially expressed mRNAs were implicated in several biological processes, such as metabolic pathways, protein processing in the endoplasmic reticulum, MAPK signaling, and the Advanced glycation end products-receptor For Advanced Glycation End(AGE-RAGE) signaling pathway in diabetic complications (Figure 5B, D). The network constructed with the lncRNAs and mRNAs differentially expressed between the Hg and Ng groups showed that lncRNA ENST00000514869 (up-regulated expression) and lncRNA ENST00000607068 (down-regulated expression) were positively correlated with the transcripts encoding zinc finger protein (ZNF), C-X-C motif chemokine ligand 2 (CXCL2), VEGFA, and TGF-β (Figure 5A). Analysis of Hg and DAPA groups revealed that lncRNA ENST00000608684 (up-regulated expression) and the lncRNA T127088 (down-regulated expression) correlated with the transcripts encoding vascular endothelial growth factor A (VEGFA), C-C motif chemokine ligand 2 (CCL2), and bolA family member 2B (BOLA2B) (Figure 5C). Thus, this approach allowed us to not only deduce the lncRNAs related to the mRNAs of interest but also assess the effect of DAPA on HK-2 cells.

Co-expression of lncRNA–mRNA pairs and their functional prediction. (A) LncRNAs and the potential cis- and trans-regulated target genes located nearby are presented in the network between the Ng and Hg groups. (B) KEGG analysis for targeted genes of differentially expressed lncRNAs between the Ng and Hg groups. (C) LncRNAs and the potential cis- and trans-regulated target genes located nearby are presented in the network between the Hg and DAPA groups. (D) KEGG analysis for targeted genes of differentially expressed lncRNAs between the Hg and DAPA groups. Red color and blue color of diamond nodes represent up and down-regulated lncRNAs, respectively. The square nodes of yellow and green represent up- and down-regulated mRNAs, respectively. CE, co-expression; DAPA: dapagliflozin. Hg: high glucose; KEGG, Kyoto Encyclopedia of Genes and Genomes; Ng: normal glucose.

We hypothesized that the DAPA-induced lncRNAs play a critical role in ameliorating HK-2 cell injury. To evaluate this, we constructed a Venn diagram of the lncRNAs and mRNAs differentially expressed between the Hg and Ng groups and the Hg and DAPA groups. These analyses revealed 89 lncRNAs whose expression levels underwent significant changes simultaneously in the three groups (fold change ≥2.5, P < 0.05) (Figure 6A, B). Among them, we selected six lncRNAs according to their fold-changes, and constructed a CNC network using their related mRNAs. To detect significant modules in this CNC network, we used cytoHubba [20] in the Cytoscape to determine key genes based on their properties (degree, edge-percolated component, maximum neighborhood component, density of maximum neighborhood component, maximal clique centrality, and six centralities) (Figure 6C, E). We further performed KEGG enrichment analysis and found that these lncRNA-related mRNAs mainly participated in the following pathways: microRNAs in cancer pathway, MAPK signaling pathway, oxidative phosphorylation, neuroactive ligand–receptor interaction, and transcriptional mis-regulation, among other biological signaling pathways (Figure 6D, F). Next, we verified the changes in the expression profile of six lncRNAs identified in HK-2 cells treated with or without DAPA using RT-qPCR. Expression levels of NR_047558, ENST00000605056, and uc031qjg.1 were significantly increased in the Hg group and decreased after DAPA treatment. Meanwhile, expression levels of NR_027051 and ENST00000606424 were decreased in the Hg group and increased after DAPA treatment, which was consistent with the results of the microarray analysis (Figure 6G). Additionally, we explore the role of canagliflozin (CANA), another class of SGLT2 inhibitor, in HK-2 cells induced by Hg. Interestingly, the expression levels of NR_027051 and ENST00000606424 were decreased in the Hg group but there were no changes in the CANA group. Meanwhile, NR_047558, uc031qjg.1, and ENST00000505796 were significantly increased in the Hg group but decreased after CANA treatment (Figure 6H). Collectively, these results suggest that SGLT2 inhibitors may reverse HK-2 cell damage induced by Hg, and thus, provide new therapeutic strategies for DKD.

The CE network of lncRNA–mRNA between the Ng, Hg, and DAPA groups. (A, B) Venn diagram of overlapping differentially expressed lncRNAs reversed by DAPA. (C) LncRNA–mRNA network and the hub genes which were down-regulated in the Hg group but up-regulated in the DAPA group. (D) KEGG analysis for targeted genes which were down-regulated in the Hg group but up-regulated in the DAPA group. (E) LncRNA–mRNA network and the hub genes which were up-regulated in the Hg group but down-regulated in the DAPA group. (F) KEGG analysis for targeted genes which were up-regulated in the Hg group but down-regulated in the DAPA group. (G, H) Validation of the expression of significant lncRNAs by qRT-PCR. CANA, canagliflozin; CE, co-expression; DAPA: dapagliflozin; Hg: high glucose; KEGG, Kyoto Encyclopedia of Genes and Genomes; Ng: normal glucose; SD, standard deviation. The data displayed in the histograms are presented as the means ± SD. *P < 0.05 vs. Ng; #P < 0.05 vs. Hg.

LncRNA–miRNA–mRNA CE network construction

CeRNAs regulate other transcripts by competing for shared miRNA response elements (MREs). Thus, we constructed a ceRNA network (lncRNA–miRNA and miRNA–mRNA CE networks) for HK-2 cells to demonstrate the regulatory relationships among lncRNAs, mRNAs, and miRNAs. Four differentially expressed mRNAs among the Ng, Hg, and DAPA groups, sharing common MRE sites in several lncRNAs, were selected (Figure 7). Some miRNAs are reportedly associated with diabetes mellitus. For example, miR-27a protects HK-2 cells against Hg-induced apoptosis and autophagy [21]. In contrast, repression of miR-29a increases collagen IV production in HK-2 cells [22]. In our study, these miRNAs and mRNAs indirectly predicted the partial functions of lncRNAs. We believe that further evaluation of different RNA interactions would provide additional insights into the mechanisms underlying therapeutic effects of DAPA in DKD.

lncRNA–miRNA–mRNA CE network construction. Green nodes represent lncRNAs, red nodes represent miRNAs, and blue nodes represent mRNAs. CE, co-expression; lncRNA, long noncoding RNAs.

Discussion

Recent evidence suggests that tubular injury can lead to glomerulosclerosis, ultimately promoting DKD development. DAPA, an SGLT2 inhibitor, can slow the progression of kidney function decline. A recent study showed that DAPA improved tubular reabsorption of filtered albumin and potentially decreased albuminuria [23]. Additionally, in our previous study, we demonstrated that DAPA protects against tubular injury in diabetic mice [24]. However, the mechanisms underlying its beneficial effects against DKD are not completely understood yet. Here, we examined the effect of DAPA treatment on HK-2 cells and laid the foundation for exploring the pathogenic mechanism of DAPA and new therapeutic targets for DKD.

Recent technical advances have facilitated the identification of a few lncRNAs that participate in DKD pathogenesis. For example, the lncRNA taurine up-regulated 1 (Tug1) modulates mitochondrial bioenergetics in podocytes of diabetic mice by binding to the mRNA encoding PGC-1α [25]. However, to our knowledge, the role of lncRNA differentially expressed in HK-2 cells treated with DAPA has not been elucidated to date. In this study, we performed microarray analysis to better understand the potential role of lncRNAs in DAPA-treated HK-2 cells. Our results identified lncRNAs and mRNAs differentially expressed between the Ng, Hg, and DAPA groups. We further analyzed the expression signatures of DAPA-induced lncRNAs and found that the majority were natural antisense noncoding RNAs. Considering the various classes of lncRNAs and their mechanisms, the signature lncRNA expression profile observed in response to DAPA treatment provides novel directions for future research in DKD treatment.

To further explore the function of these differentially expressed lncRNAs, GO and KEGG pathway analyses were performed. Compared to the Ng group, the differentially expressed mRNAs were enriched in the type I diabetes mellitus signaling, cell cycle, oxidative stress, and metabolic process. However, in the DAPA intervention group, the significantly enriched GO processes were mainly related to the regulation of the collagen biosynthetic process, regulation of programmed cell death, and apoptotic signaling pathway, indicating that DAPA may regulate apoptosis and fibrosis in HK-2 cells. Additionally, KEGG pathway analysis revealed that these transcripts were enriched in type I diabetes mellitus, MAPK signaling pathway, ECM–receptor interaction, and cell cycle signaling pathways. Interestingly, our study revealed that transcriptional dysregulation in cancer, MAPK signaling pathway, p53 signaling pathway, and PI3K-Akt signaling pathway were significantly altered after DAPA treatment, suggesting that DAPA may protect kidneys by regulating these pathways. In line with the previously studied molecular mechanism [26], the results of GO and KEGG analyses collectively revealed that regulation of cell cycle and apoptosis is important for maintaining normal renal physiology.

We further investigated some lncRNAs differentially expressed using Venn diagrams and established a lncRNA–mRNA network containing six lncRNAs and 266 mRNAs. Previous studies have reported that metformin can decrease oxidative stress via the Adenosine 5‘-mono-phosphate (AMP)-activated protein kinase (AMPK) signaling pathway and improve diabetes-associated renal injury [27]. In addition, Dipeptidyl Peptidase-4 (DPP-4) (DPP-4) inhibition, independent of glucagon-like peptide-1 (GLP-1R) signaling, protects diabetic kidneys through Stromal cell-derived factor 1 (SDF-1) dependent antioxi-dative and antifibrotic effects [28]. Our results showed that DAPA exerts its protective effects on HK-2 cells via different signaling pathways than metformin and DPP-4. CE analysis indicated that the hub genes regulated by lncRNAs were enriched in microRNAs in cancer, the MAPK signaling pathway, and oxidative phosphorylation. Notably, the expression levels of NR_027051, ENST00000606424, NR_047558, ENST00000605056, and uc031qjg.1 analyzed through RT-qPCR were consistent with RNA microarray results. Interestingly, although CANA has the same role as DAPA, they have different target lncRNAs, which need to be further studied. Overall, these results highlight the effects of SGLT2 inhibitors in modulating Hg-induced HK-2 cells injury.

An increasing number of studies have revealed that lncRNAs and mRNAs compete for the same MREs to regulate gene expression. Moreover, lncRNAs can act as ceRNAs and participate in DKD progression [29, 30]. For example, the lncRNA GAS5 inhibits mesangial cell proliferation and fibrosis by sponging miR-221 in diabetic nephropathy [31]. However, the molecular mechanism of lncRNAs and their possible role as ceRNAs in HK-2 cells treated with DAPA remain unclear. In this study, ceRNA networks were systematically constructed and mRNA-related ceRNA networks were dissected to provide insights into the mechanism underlying DAPA action. We found that a significant proportion of miRNAs were related to diabetes-related functions, indicating that ceRNA molecular networks are crucial in the molecular mechanism of DAPA action in DKD. Additionally, we found that some ceRNA molecules were related to biological processes such as cell growth and apoptosis, anti-inflammation, and epithelial-mesenchymal transition, providing new clues for exploring key therapeutic targets of DKD treatment.

In summary, our study details the changes in expression levels of lncRNAs and mRNAs in HK-2 cells after DAPA treatment. The results indicate that lncRNAs play an important role in the mechanism underlying DAPA action and that bioinformatics analyses in the future may enable a better understanding of these mechanisms. Further, elucidation of the exact regulatory mechanisms of specific lncRNAs by DAPA is warranted in future studies.

Figure 1

Differentially expressed lncRNAs and mRNAs in HK-2 cells cultured in in Ng, Hg, and Hg plus DAPA. (A, B) Scatter plots of the differentially expressed lncRNAs between Ng and Hg groups (A); DAPA and Hg groups (B). (C, D) Scatter plots of the differentially expressed mRNAs between Ng and Hg groups (C); DAPA and Hg groups (D). (E, F) Volcano plots of the differentially expressed lncRNAs between Ng and Hg groups (E); DAPA and Hg groups (F). (G, H) Volcano plots of the differentially expressed mRNAs between Ng and Hg groups (G); DAPA and Hg groups (H). (Fold-changes ≥2.0 and P < 0.05). DAPA, dapagliflozin; Hg, high glucose; Ng, normal glucose.
Differentially expressed lncRNAs and mRNAs in HK-2 cells cultured in in Ng, Hg, and Hg plus DAPA. (A, B) Scatter plots of the differentially expressed lncRNAs between Ng and Hg groups (A); DAPA and Hg groups (B). (C, D) Scatter plots of the differentially expressed mRNAs between Ng and Hg groups (C); DAPA and Hg groups (D). (E, F) Volcano plots of the differentially expressed lncRNAs between Ng and Hg groups (E); DAPA and Hg groups (F). (G, H) Volcano plots of the differentially expressed mRNAs between Ng and Hg groups (G); DAPA and Hg groups (H). (Fold-changes ≥2.0 and P < 0.05). DAPA, dapagliflozin; Hg, high glucose; Ng, normal glucose.

Figure 2

Signature lncRNA expression in the Hg and Hg + DAPA groups. (A) The numbers of lncRNAs from various databases. (B) The classification of lncRNAs. (C) The distribution of differentially expressed lncRNAs based on the length of nuclear acids. (D) The number of reads mapped to each chromosome. DAPA, dapagliflozin; Hg, high glucose.
Signature lncRNA expression in the Hg and Hg + DAPA groups. (A) The numbers of lncRNAs from various databases. (B) The classification of lncRNAs. (C) The distribution of differentially expressed lncRNAs based on the length of nuclear acids. (D) The number of reads mapped to each chromosome. DAPA, dapagliflozin; Hg, high glucose.

Figure 3

GO and KEGG pathway enrichment analysis of differentially expressed lncRNA corresponding genes. (A, B) GO annotations for biological process category of the up-regulated (A) and down-regulated (B) genes between the Ng and Hg groups. (C, D) GO annotations for biological process category of the up-regulated (C) and down-regulated (D) genes between the DAPA and Hg groups. (E, F) KEGG analysis of the up-regulated (E) and down-regulated genes (F) between the Ng and Hg groups. (G, H) KEGG analysis of the up-regulated (G) and down-regulated genes (H) between the DAPA and Hg groups. Enrichment score values were calculated as −log10 (P-Values). DAPA, dapagliflozin; GO, gene ontology; Hg, high glucose; KEGG, Kyoto Encyclopedia of Genes and Genomes; Ng, normal glucose.
GO and KEGG pathway enrichment analysis of differentially expressed lncRNA corresponding genes. (A, B) GO annotations for biological process category of the up-regulated (A) and down-regulated (B) genes between the Ng and Hg groups. (C, D) GO annotations for biological process category of the up-regulated (C) and down-regulated (D) genes between the DAPA and Hg groups. (E, F) KEGG analysis of the up-regulated (E) and down-regulated genes (F) between the Ng and Hg groups. (G, H) KEGG analysis of the up-regulated (G) and down-regulated genes (H) between the DAPA and Hg groups. Enrichment score values were calculated as −log10 (P-Values). DAPA, dapagliflozin; GO, gene ontology; Hg, high glucose; KEGG, Kyoto Encyclopedia of Genes and Genomes; Ng, normal glucose.

Figure 4

PPI network construction and KEGG pathway analysis. (A, B) PPI network (A) and KEGG pathway analysis (B) for differentially expressed mRNA between the Ng and Hg groups. (C, D) PPI network (C) and KEGG pathway analysis (D) for differentially expressed mRNA between the Hg and DAPA groups. Each protein is presented as a network node, and the edges represent meaningful protein–protein associations. CDB, curated data bases; CE, co-expression; DAPA: dapagliflozin; ED, experimentally determined; GC-O, gene co-occurrence; GF, gene fusions; GN, gene neighborhood; Hg: high glucose; KEGG, Kyoto Encyclopedia of Genes and Genomes; Ng: normal glucose; PH, protein homology; PPI, protein–protein interaction; TM, text mining.
PPI network construction and KEGG pathway analysis. (A, B) PPI network (A) and KEGG pathway analysis (B) for differentially expressed mRNA between the Ng and Hg groups. (C, D) PPI network (C) and KEGG pathway analysis (D) for differentially expressed mRNA between the Hg and DAPA groups. Each protein is presented as a network node, and the edges represent meaningful protein–protein associations. CDB, curated data bases; CE, co-expression; DAPA: dapagliflozin; ED, experimentally determined; GC-O, gene co-occurrence; GF, gene fusions; GN, gene neighborhood; Hg: high glucose; KEGG, Kyoto Encyclopedia of Genes and Genomes; Ng: normal glucose; PH, protein homology; PPI, protein–protein interaction; TM, text mining.

Figure 5

Co-expression of lncRNA–mRNA pairs and their functional prediction. (A) LncRNAs and the potential cis- and trans-regulated target genes located nearby are presented in the network between the Ng and Hg groups. (B) KEGG analysis for targeted genes of differentially expressed lncRNAs between the Ng and Hg groups. (C) LncRNAs and the potential cis- and trans-regulated target genes located nearby are presented in the network between the Hg and DAPA groups. (D) KEGG analysis for targeted genes of differentially expressed lncRNAs between the Hg and DAPA groups. Red color and blue color of diamond nodes represent up and down-regulated lncRNAs, respectively. The square nodes of yellow and green represent up- and down-regulated mRNAs, respectively. CE, co-expression; DAPA: dapagliflozin. Hg: high glucose; KEGG, Kyoto Encyclopedia of Genes and Genomes; Ng: normal glucose.
Co-expression of lncRNA–mRNA pairs and their functional prediction. (A) LncRNAs and the potential cis- and trans-regulated target genes located nearby are presented in the network between the Ng and Hg groups. (B) KEGG analysis for targeted genes of differentially expressed lncRNAs between the Ng and Hg groups. (C) LncRNAs and the potential cis- and trans-regulated target genes located nearby are presented in the network between the Hg and DAPA groups. (D) KEGG analysis for targeted genes of differentially expressed lncRNAs between the Hg and DAPA groups. Red color and blue color of diamond nodes represent up and down-regulated lncRNAs, respectively. The square nodes of yellow and green represent up- and down-regulated mRNAs, respectively. CE, co-expression; DAPA: dapagliflozin. Hg: high glucose; KEGG, Kyoto Encyclopedia of Genes and Genomes; Ng: normal glucose.

Figure 6

The CE network of lncRNA–mRNA between the Ng, Hg, and DAPA groups. (A, B) Venn diagram of overlapping differentially expressed lncRNAs reversed by DAPA. (C) LncRNA–mRNA network and the hub genes which were down-regulated in the Hg group but up-regulated in the DAPA group. (D) KEGG analysis for targeted genes which were down-regulated in the Hg group but up-regulated in the DAPA group. (E) LncRNA–mRNA network and the hub genes which were up-regulated in the Hg group but down-regulated in the DAPA group. (F) KEGG analysis for targeted genes which were up-regulated in the Hg group but down-regulated in the DAPA group. (G, H) Validation of the expression of significant lncRNAs by qRT-PCR. CANA, canagliflozin; CE, co-expression; DAPA: dapagliflozin; Hg: high glucose; KEGG, Kyoto Encyclopedia of Genes and Genomes; Ng: normal glucose; SD, standard deviation. The data displayed in the histograms are presented as the means ± SD. *P < 0.05 vs. Ng; #P < 0.05 vs. Hg.
The CE network of lncRNA–mRNA between the Ng, Hg, and DAPA groups. (A, B) Venn diagram of overlapping differentially expressed lncRNAs reversed by DAPA. (C) LncRNA–mRNA network and the hub genes which were down-regulated in the Hg group but up-regulated in the DAPA group. (D) KEGG analysis for targeted genes which were down-regulated in the Hg group but up-regulated in the DAPA group. (E) LncRNA–mRNA network and the hub genes which were up-regulated in the Hg group but down-regulated in the DAPA group. (F) KEGG analysis for targeted genes which were up-regulated in the Hg group but down-regulated in the DAPA group. (G, H) Validation of the expression of significant lncRNAs by qRT-PCR. CANA, canagliflozin; CE, co-expression; DAPA: dapagliflozin; Hg: high glucose; KEGG, Kyoto Encyclopedia of Genes and Genomes; Ng: normal glucose; SD, standard deviation. The data displayed in the histograms are presented as the means ± SD. *P < 0.05 vs. Ng; #P < 0.05 vs. Hg.

Figure 7

lncRNA–miRNA–mRNA CE network construction. Green nodes represent lncRNAs, red nodes represent miRNAs, and blue nodes represent mRNAs. CE, co-expression; lncRNA, long noncoding RNAs.
lncRNA–miRNA–mRNA CE network construction. Green nodes represent lncRNAs, red nodes represent miRNAs, and blue nodes represent mRNAs. CE, co-expression; lncRNA, long noncoding RNAs.

Figure 1

Differentially expressed lncRNAs and mRNAs in HK-2 cells cultured in in Ng, Hg, and Hg plus DAPA. (A, B) Scatter plots of the differentially expressed lncRNAs between Ng and Hg groups (A); DAPA and Hg groups (B). (C, D) Scatter plots of the differentially expressed mRNAs between Ng and Hg groups (C); DAPA and Hg groups (D). (E, F) Volcano plots of the differentially expressed lncRNAs between Ng and Hg groups (E); DAPA and Hg groups (F). (G, H) Volcano plots of the differentially expressed mRNAs between Ng and Hg groups (G); DAPA and Hg groups (H). (Fold-changes ≥2.0 and P < 0.05). DAPA, dapagliflozin; Hg, high glucose; Ng, normal glucose.
Differentially expressed lncRNAs and mRNAs in HK-2 cells cultured in in Ng, Hg, and Hg plus DAPA. (A, B) Scatter plots of the differentially expressed lncRNAs between Ng and Hg groups (A); DAPA and Hg groups (B). (C, D) Scatter plots of the differentially expressed mRNAs between Ng and Hg groups (C); DAPA and Hg groups (D). (E, F) Volcano plots of the differentially expressed lncRNAs between Ng and Hg groups (E); DAPA and Hg groups (F). (G, H) Volcano plots of the differentially expressed mRNAs between Ng and Hg groups (G); DAPA and Hg groups (H). (Fold-changes ≥2.0 and P < 0.05). DAPA, dapagliflozin; Hg, high glucose; Ng, normal glucose.

Figure 2

Signature lncRNA expression in the Hg and Hg + DAPA groups. (A) The numbers of lncRNAs from various databases. (B) The classification of lncRNAs. (C) The distribution of differentially expressed lncRNAs based on the length of nuclear acids. (D) The number of reads mapped to each chromosome. DAPA, dapagliflozin; Hg, high glucose.
Signature lncRNA expression in the Hg and Hg + DAPA groups. (A) The numbers of lncRNAs from various databases. (B) The classification of lncRNAs. (C) The distribution of differentially expressed lncRNAs based on the length of nuclear acids. (D) The number of reads mapped to each chromosome. DAPA, dapagliflozin; Hg, high glucose.

Figure 3

GO and KEGG pathway enrichment analysis of differentially expressed lncRNA corresponding genes. (A, B) GO annotations for biological process category of the up-regulated (A) and down-regulated (B) genes between the Ng and Hg groups. (C, D) GO annotations for biological process category of the up-regulated (C) and down-regulated (D) genes between the DAPA and Hg groups. (E, F) KEGG analysis of the up-regulated (E) and down-regulated genes (F) between the Ng and Hg groups. (G, H) KEGG analysis of the up-regulated (G) and down-regulated genes (H) between the DAPA and Hg groups. Enrichment score values were calculated as −log10 (P-Values). DAPA, dapagliflozin; GO, gene ontology; Hg, high glucose; KEGG, Kyoto Encyclopedia of Genes and Genomes; Ng, normal glucose.
GO and KEGG pathway enrichment analysis of differentially expressed lncRNA corresponding genes. (A, B) GO annotations for biological process category of the up-regulated (A) and down-regulated (B) genes between the Ng and Hg groups. (C, D) GO annotations for biological process category of the up-regulated (C) and down-regulated (D) genes between the DAPA and Hg groups. (E, F) KEGG analysis of the up-regulated (E) and down-regulated genes (F) between the Ng and Hg groups. (G, H) KEGG analysis of the up-regulated (G) and down-regulated genes (H) between the DAPA and Hg groups. Enrichment score values were calculated as −log10 (P-Values). DAPA, dapagliflozin; GO, gene ontology; Hg, high glucose; KEGG, Kyoto Encyclopedia of Genes and Genomes; Ng, normal glucose.

Figure 4

PPI network construction and KEGG pathway analysis. (A, B) PPI network (A) and KEGG pathway analysis (B) for differentially expressed mRNA between the Ng and Hg groups. (C, D) PPI network (C) and KEGG pathway analysis (D) for differentially expressed mRNA between the Hg and DAPA groups. Each protein is presented as a network node, and the edges represent meaningful protein–protein associations. CDB, curated data bases; CE, co-expression; DAPA: dapagliflozin; ED, experimentally determined; GC-O, gene co-occurrence; GF, gene fusions; GN, gene neighborhood; Hg: high glucose; KEGG, Kyoto Encyclopedia of Genes and Genomes; Ng: normal glucose; PH, protein homology; PPI, protein–protein interaction; TM, text mining.
PPI network construction and KEGG pathway analysis. (A, B) PPI network (A) and KEGG pathway analysis (B) for differentially expressed mRNA between the Ng and Hg groups. (C, D) PPI network (C) and KEGG pathway analysis (D) for differentially expressed mRNA between the Hg and DAPA groups. Each protein is presented as a network node, and the edges represent meaningful protein–protein associations. CDB, curated data bases; CE, co-expression; DAPA: dapagliflozin; ED, experimentally determined; GC-O, gene co-occurrence; GF, gene fusions; GN, gene neighborhood; Hg: high glucose; KEGG, Kyoto Encyclopedia of Genes and Genomes; Ng: normal glucose; PH, protein homology; PPI, protein–protein interaction; TM, text mining.

Figure 5

Co-expression of lncRNA–mRNA pairs and their functional prediction. (A) LncRNAs and the potential cis- and trans-regulated target genes located nearby are presented in the network between the Ng and Hg groups. (B) KEGG analysis for targeted genes of differentially expressed lncRNAs between the Ng and Hg groups. (C) LncRNAs and the potential cis- and trans-regulated target genes located nearby are presented in the network between the Hg and DAPA groups. (D) KEGG analysis for targeted genes of differentially expressed lncRNAs between the Hg and DAPA groups. Red color and blue color of diamond nodes represent up and down-regulated lncRNAs, respectively. The square nodes of yellow and green represent up- and down-regulated mRNAs, respectively. CE, co-expression; DAPA: dapagliflozin. Hg: high glucose; KEGG, Kyoto Encyclopedia of Genes and Genomes; Ng: normal glucose.
Co-expression of lncRNA–mRNA pairs and their functional prediction. (A) LncRNAs and the potential cis- and trans-regulated target genes located nearby are presented in the network between the Ng and Hg groups. (B) KEGG analysis for targeted genes of differentially expressed lncRNAs between the Ng and Hg groups. (C) LncRNAs and the potential cis- and trans-regulated target genes located nearby are presented in the network between the Hg and DAPA groups. (D) KEGG analysis for targeted genes of differentially expressed lncRNAs between the Hg and DAPA groups. Red color and blue color of diamond nodes represent up and down-regulated lncRNAs, respectively. The square nodes of yellow and green represent up- and down-regulated mRNAs, respectively. CE, co-expression; DAPA: dapagliflozin. Hg: high glucose; KEGG, Kyoto Encyclopedia of Genes and Genomes; Ng: normal glucose.

Figure 6

The CE network of lncRNA–mRNA between the Ng, Hg, and DAPA groups. (A, B) Venn diagram of overlapping differentially expressed lncRNAs reversed by DAPA. (C) LncRNA–mRNA network and the hub genes which were down-regulated in the Hg group but up-regulated in the DAPA group. (D) KEGG analysis for targeted genes which were down-regulated in the Hg group but up-regulated in the DAPA group. (E) LncRNA–mRNA network and the hub genes which were up-regulated in the Hg group but down-regulated in the DAPA group. (F) KEGG analysis for targeted genes which were up-regulated in the Hg group but down-regulated in the DAPA group. (G, H) Validation of the expression of significant lncRNAs by qRT-PCR. CANA, canagliflozin; CE, co-expression; DAPA: dapagliflozin; Hg: high glucose; KEGG, Kyoto Encyclopedia of Genes and Genomes; Ng: normal glucose; SD, standard deviation. The data displayed in the histograms are presented as the means ± SD. *P < 0.05 vs. Ng; #P < 0.05 vs. Hg.
The CE network of lncRNA–mRNA between the Ng, Hg, and DAPA groups. (A, B) Venn diagram of overlapping differentially expressed lncRNAs reversed by DAPA. (C) LncRNA–mRNA network and the hub genes which were down-regulated in the Hg group but up-regulated in the DAPA group. (D) KEGG analysis for targeted genes which were down-regulated in the Hg group but up-regulated in the DAPA group. (E) LncRNA–mRNA network and the hub genes which were up-regulated in the Hg group but down-regulated in the DAPA group. (F) KEGG analysis for targeted genes which were up-regulated in the Hg group but down-regulated in the DAPA group. (G, H) Validation of the expression of significant lncRNAs by qRT-PCR. CANA, canagliflozin; CE, co-expression; DAPA: dapagliflozin; Hg: high glucose; KEGG, Kyoto Encyclopedia of Genes and Genomes; Ng: normal glucose; SD, standard deviation. The data displayed in the histograms are presented as the means ± SD. *P < 0.05 vs. Ng; #P < 0.05 vs. Hg.

Figure 7

lncRNA–miRNA–mRNA CE network construction. Green nodes represent lncRNAs, red nodes represent miRNAs, and blue nodes represent mRNAs. CE, co-expression; lncRNA, long noncoding RNAs.
lncRNA–miRNA–mRNA CE network construction. Green nodes represent lncRNAs, red nodes represent miRNAs, and blue nodes represent mRNAs. CE, co-expression; lncRNA, long noncoding RNAs.

Representative overlapped differentially expressed lncRNAs (Top 10, Hg vs. Ng)

lncRNA ID lncRNA regulation lncRNA ID lncRNA regulation
T379873 Up ENST00000607068 Down
ENST00000514869 Up ENST00000501143 Down
T036399 Up T206052 Down
ENST00000608672 Up ENST00000608721 Down
ENST00000594512 Up ENST00000577848 Down
NR_102703 Up ENST00000515422 Down
T251871 Up ENST00000605281 Down
T252353 Up T378692 Down
uc.350+ Up ENST00000572811 Down
T136710 Up NR_047116 Down

Representative overlapped differentially expressed lncRNAs (Top 10, DAPA vs. Hg)

lncRNA ID lncRNA regulation lncRNA ID lncRNA regulation
T292663 Up T008148 Down
T152286 Up T127088 Down
ENST00000608684 Up T221412 Down
ENST00000505796 Up NR_047558 Down
NR_027242 Up T347175 Down
NR_027051 Up GSE61474_TCONS_00118477 Down
ENST00000606424 Up T268044 Down
ENST00000608517 Up ENST00000596971 Down
ENST00000441312 Up ENST00000605056 Down
ENST00000607068 Up uc031qjg.1 Down

Sequence of the primers used for qRT-PCR

lncRNA Forward sequence (5′–3′) Reverse sequence (5′–3′)
NR_027051 AGGTGGTCAGGATGGAGTTGTAGG AAGCGGCTCTCGGTGGACTAC
ENST00000606424 TCCTGATGAAGTGCCAACTGAAGC ACGCAAAAGAATCCATCCCACACC
NR_047558 CGCATCCAGCCATCAACTGACTC AGAGGTGGTGACTGAGGTCGTAAG
ENST00000605056 CCTGAGTGCTGAGGAACAGTGAAC CTGGAGGTGAGGCTGGTGAGG
uc031qjg.1 GGGAAGCAAGGTTCGCCATCC AGAGCAGACAGCAGTGAGAGGAG
ENST00000505796 ACAAGGATCTGAGGAATGTGGC AACTGTATGGGCGAGGCAGA

Packer M. Role of impaired nutrient and oxygen deprivation signaling and deficient autophagic flux in diabetic CKD development: implications for understanding the effects of sodium-glucose cotransporter 2-inhibitors. J Am Soc Nephrol 2020; 31: 907–19. PackerM Role of impaired nutrient and oxygen deprivation signaling and deficient autophagic flux in diabetic CKD development: implications for understanding the effects of sodium-glucose cotransporter 2-inhibitors J Am Soc Nephrol 2020 31 907 19 10.1681/ASN.2020010010721742132276962 Search in Google Scholar

Sotokawauchi A, Nakamura N, Matsui T, Higashimoto Y, Yamagishi S-I. Glyceraldehyde-derived pyridinium evokes renal tubular cell damage via RAGE interaction. Int J Mol Sci 2020; 21: 2604. SotokawauchiA NakamuraN MatsuiT HigashimotoY YamagishiS-I Glyceraldehyde-derived pyridinium evokes renal tubular cell damage via RAGE interaction Int J Mol Sci 2020 21 2604 10.3390/ijms21072604717783232283652 Search in Google Scholar

Wang J-N, Yang Q, Yang C, Cai Y-T, Xing T, Gao L, et al. Smad3 promotes AKI sensitivity in diabetic mice via interaction with p53 and induction of NOX4-dependent ROS production. Redox Biol 2020; 32: 101479. WangJ-N YangQ YangC CaiY-T XingT GaoL Smad3 promotes AKI sensitivity in diabetic mice via interaction with p53 and induction of NOX4-dependent ROS production Redox Biol 2020 32 101479 10.1016/j.redox.2020.101479705841032143149 Search in Google Scholar

Fontecha-Barriuso M, Martin-Sanchez D, Martinez-Moreno JM, Monsalve M, Ramos AM, Sanchez-Niño MD, et al. The role of PGC-1α and mitochondrial biogenesis in kidney diseases. Biomolecules 2020; 10: 347. Fontecha-BarriusoM Martin-SanchezD Martinez-MorenoJM MonsalveM RamosAM Sanchez-NiñoMD The role of PGC-1α and mitochondrial biogenesis in kidney diseases Biomolecules 2020 10 347 10.3390/biom10020347707261432102312 Search in Google Scholar

Chen S-J, Lv L-L, Liu B-C, Tang R-N. Crosstalk between tubular epithelial cells and glomerular endothelial cells in diabetic kidney disease. Cell Prolif 2020; 53: e12763. ChenS-J LvL-L LiuB-C TangR-N Crosstalk between tubular epithelial cells and glomerular endothelial cells in diabetic kidney disease Cell Prolif 2020 53 e12763 10.1111/cpr.12763710695931925859 Search in Google Scholar

Kirk R. Diabetes: efficacy of dapagliflozin associated with renal function. Nat Rev Endocrinol 2013; 9: 688. KirkR Diabetes: efficacy of dapagliflozin associated with renal function Nat Rev Endocrinol 2013 9 688 10.1038/nrendo.2013.20624126478 Search in Google Scholar

Heerspink HJL, Stefánsson BV, Correa-Rotter R, Chertow GM, Greene T, Hou F-F, et al. Dapagliflozin in patients with chronic kidney disease. N Engl J Med 2020; 383: 1436–46. HeerspinkHJL StefánssonBV Correa-RotterR ChertowGM GreeneT HouF-F Dapagliflozin in patients with chronic kidney disease N Engl J Med 2020 383 1436 46 10.1056/NEJMoa202481632970396 Search in Google Scholar

Baer PC, Koch B, Freitag J, Schubert R, Geiger H, No cytotoxic and inflammatory effects of empagliflozin and dapagliflozin on primary renal proximal tubular epithelial cells under diabetic conditions in vitro. Int J Mol Sci 2020; 21: 391. BaerPC KochB FreitagJ SchubertR GeigerH No cytotoxic and inflammatory effects of empagliflozin and dapagliflozin on primary renal proximal tubular epithelial cells under diabetic conditions in vitro Int J Mol Sci 2020 21 391 10.3390/ijms21020391701374631936266 Search in Google Scholar

Jaé N, Dimmeler S, Noncoding RNAs in vascular diseases. Circ Res 2020; 126: 1127–45. JaéN DimmelerS Noncoding RNAs in vascular diseases Circ Res 2020 126 1127 45 10.1161/CIRCRESAHA.119.31593832324505 Search in Google Scholar

Shang A, Wang W, Gu C, Chen W, Lu W, Sun Z, et al. Long non-coding RNA CCAT1 promotes colorectal cancer progression by regulating miR-181a-5p expression. Aging (Albany NY) 2020; 12: 8301–20. ShangA WangW GuC ChenW LuW SunZ Long non-coding RNA CCAT1 promotes colorectal cancer progression by regulating miR-181a-5p expression Aging (Albany NY) 2020 12 8301 20 10.18632/aging.103139724403732380476 Search in Google Scholar

Huang W-J, Tian X-P, Bi S-X, Zhang S-R, He T-S, Song L-Y, et al. The β-catenin/TCF-4-LINC01278-miR-1258-Smad2/3 axis promotes hepatocellular carcinoma metastasis. Oncogene 2020; 39: 4538–50. HuangW-J TianX-P BiS-X ZhangS-R HeT-S SongL-Y The β-catenin/TCF-4-LINC01278-miR-1258-Smad2/3 axis promotes hepatocellular carcinoma metastasis Oncogene 2020 39 4538 50 10.1038/s41388-020-1307-3726991132372060 Search in Google Scholar

Trembinski DJ, Bink DI, Theodorou K, Sommer J, Fischer A, van Bergen A, et al. Aging-regulated anti-apoptotic long non-coding RNA Sarrah augments recovery from acute myocardial infarction. Nat Commun 2020; 11: 2039. TrembinskiDJ BinkDI TheodorouK SommerJ FischerA van BergenA Aging-regulated anti-apoptotic long non-coding RNA Sarrah augments recovery from acute myocardial infarction Nat Commun 2020 11 2039 10.1038/s41467-020-15995-2718472432341350 Search in Google Scholar

Zhu S, Wang J-Z, Chen D, He Y-T, Meng N, Chen M, et al. An oncopeptide regulates mA recognition by the mA reader IGF2BP1 and tumorigenesis. Nat Commun 2020; 11: 1685. ZhuS WangJ-Z ChenD HeY-T MengN ChenM An oncopeptide regulates mA recognition by the mA reader IGF2BP1 and tumorigenesis Nat Commun 2020 11 1685 10.1038/s41467-020-15403-9712511932245947 Search in Google Scholar

Zhang R, Li J, Huang T, Wang X, Danggui buxue tang suppresses high glucose-induced proliferation and extracellular matrix accumulation of mesangial cells via inhibiting lncRNA PVT1. Am J Transl Res 2017; 9: 3732–40. ZhangR LiJ HuangT WangX Danggui buxue tang suppresses high glucose-induced proliferation and extracellular matrix accumulation of mesangial cells via inhibiting lncRNA PVT1 Am J Transl Res 2017 9 3732 40 Search in Google Scholar

Yi H, Peng R, Zhang L-Y, Sun Y, Peng H-M, Liu H-D, et al. LincRNA-Gm4419 knockdown ameliorates NF-κB/NLRP3 inflammasome-mediated inflammation in diabetic nephropathy. Cell Death Dis 2017; 8: e2583. YiH PengR ZhangL-Y SunY PengH-M LiuH-D LincRNA-Gm4419 knockdown ameliorates NF-κB/NLRP3 inflammasome-mediated inflammation in diabetic nephropathy Cell Death Dis 2017 8 e2583 10.1038/cddis.2016.451538645428151474 Search in Google Scholar

Dennis G, Sherman BT, Hosack DA, Yang J, Gao W, Lane HC, et al. DAVID: database for annotation, visualization, and integrated discovery. Genome Biol 2003; 4: P3. DennisG ShermanBT HosackDA YangJ GaoW LaneHC DAVID: database for annotation, visualization, and integrated discovery Genome Biol 2003 4 P3 10.1186/gb-2003-4-5-p3 Search in Google Scholar

Szklarczyk D, Gable AL, Lyon D, Junge A, Wyder S, Huerta-Cepas J, et al. STRING v11: protein-protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucleic Acids Res 2019; 47: D607–13. SzklarczykD GableAL LyonD JungeA WyderS Huerta-CepasJ STRING v11: protein-protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets Nucleic Acids Res 2019 47 D607 13 10.1093/nar/gky1131632398630476243 Search in Google Scholar

Li J, Ma W, Zeng P, Wang J, Geng B, Yang J, et al. LncTar: a tool for predicting the RNA targets of long noncoding RNAs. Brief Bioinform 2015; 16: 806–12. LiJ MaW ZengP WangJ GengB YangJ LncTar: a tool for predicting the RNA targets of long noncoding RNAs Brief Bioinform 2015 16 806 12 10.1093/bib/bbu04825524864 Search in Google Scholar

Shannon P, Markiel A, Ozier O, Baliga NS, Wang JT, Ramage D, et al. Cytoscape: a software environment for integrated models of bio-molecular interaction networks. Genome Res 2003; 13: 2498–504. ShannonP MarkielA OzierO BaligaNS WangJT RamageD Cytoscape: a software environment for integrated models of bio-molecular interaction networks Genome Res 2003 13 2498 504 10.1101/gr.123930340376914597658 Search in Google Scholar

Chin C-H, Chen S-H, Wu H-H, Ho C-W, Ko M-T, Lin C-Y. cyto-Hubba: identifying hub objects and sub-networks from complex inter-actome. BMC Syst Biol 2014; 8(Suppl 4): S11. ChinC-H ChenS-H WuH-H HoC-W KoM-T LinC-Y cyto-Hubba: identifying hub objects and sub-networks from complex inter-actome BMC Syst Biol 2014 8 Suppl 4 S11 10.1186/1752-0509-8-S4-S11429068725521941 Search in Google Scholar

Lv L, Zhang J, Tian F, Li X, Li D, Yu X, Arbutin protects HK-2 cells against high glucose-induced apoptosis and autophagy by up-regulating microRNA-27a. Artif Cells Nanomed Biotechnol 2019; 47: 2940–7. LvL ZhangJ TianF LiX LiD YuX Arbutin protects HK-2 cells against high glucose-induced apoptosis and autophagy by up-regulating microRNA-27a Artif Cells Nanomed Biotechnol 2019 47 2940 7 10.1080/21691401.2019.164023131319730 Search in Google Scholar

Du B, Ma L-M, Huang M-B, Zhou H, Huang H-L, Shao P, et al. High glucose down-regulates miR-29a to increase collagen IV production in HK-2 cells. FEBS Lett 2010; 584: 811–6. DuB MaL-M HuangM-B ZhouH HuangH-L ShaoP High glucose down-regulates miR-29a to increase collagen IV production in HK-2 cells FEBS Lett 2010 584 811 6 10.1016/j.febslet.2009.12.05320067797 Search in Google Scholar

De Nicola L, Gabbai FB, Liberti ME, Sagliocca A, Conte G, Minutolo R, Sodium/glucose cotransporter 2 inhibitors and prevention of diabetic nephropathy: targeting the renal tubule in diabetes. Am J Kidney Dis 2014; 64: 16–24. De NicolaL GabbaiFB LibertiME SaglioccaA ConteG MinutoloR Sodium/glucose cotransporter 2 inhibitors and prevention of diabetic nephropathy: targeting the renal tubule in diabetes Am J Kidney Dis 2014 64 16 24 10.1053/j.ajkd.2014.02.01024673844 Search in Google Scholar

Huang F, Zhao Y, Wang Q, Hillebrands J-L, van den Born J, Ji L, et al. Dapagliflozin attenuates renal tubulointerstitial fibrosis associated with type 1 diabetes by regulating STAT1/TGFβ1 signaling. Front Endocrinol (Lausanne) 2019; 10: 441. HuangF ZhaoY WangQ HillebrandsJ-L van den BornJ JiL Dapagliflozin attenuates renal tubulointerstitial fibrosis associated with type 1 diabetes by regulating STAT1/TGFβ1 signaling Front Endocrinol (Lausanne) 2019 10 441 10.3389/fendo.2019.00441661608231333586 Search in Google Scholar

Li SY, Susztak K. The long noncoding RNA Tug1 connects metabolic changes with kidney disease in podocytes. J Clin Investig 2016; 126: 4072–5. LiSY SusztakK The long noncoding RNA Tug1 connects metabolic changes with kidney disease in podocytes J Clin Investig 2016 126 4072 5 10.1172/JCI90828509689527760046 Search in Google Scholar

Luo T, Yu Q, Zou H, Zhao H, Gu J, Yuan Y, et al. Role of poly (ADP-ribose) polymerase-1 in cadmium-induced cellular DNA damage and cell cycle arrest in rat renal tubular epithelial cell line NRK-52E. Environ Pollut 2020; 261: 114149. LuoT YuQ ZouH ZhaoH GuJ YuanY Role of poly (ADP-ribose) polymerase-1 in cadmium-induced cellular DNA damage and cell cycle arrest in rat renal tubular epithelial cell line NRK-52E Environ Pollut 2020 261 114149 10.1016/j.envpol.2020.11414932078880 Search in Google Scholar

Ren H, Shao Y, Wu C, Ma X, Lv C, Wang Q, Metformin alleviates oxidative stress and enhances autophagy in diabetic kidney disease via AMPK/SIRT1-FoxO1 pathway. Mol Cell Endocrinol 2020; 500: 110628. RenH ShaoY WuC MaX LvC WangQ Metformin alleviates oxidative stress and enhances autophagy in diabetic kidney disease via AMPK/SIRT1-FoxO1 pathway Mol Cell Endocrinol 2020 500 110628 10.1016/j.mce.2019.11062831647955 Search in Google Scholar

Takashima S, Fujita H, Fujishima H, Shimizu T, Sato T, Morii T, et al. Stromal cell-derived factor-1 is upregulated by dipeptidyl peptidase-4 inhibition and has protective roles in progressive diabetic nephropathy. Kidney Int 2016; 90: 783–96. TakashimaS FujitaH FujishimaH ShimizuT SatoT MoriiT Stromal cell-derived factor-1 is upregulated by dipeptidyl peptidase-4 inhibition and has protective roles in progressive diabetic nephropathy Kidney Int 2016 90 783 96 10.1016/j.kint.2016.06.01227475229 Search in Google Scholar

Li J, Zhao Q, Jin X, Li Y, Song J. Silencing of LncRNA PVT1 inhibits the proliferation, migration and fibrosis of high glucose-induced mouse mesangial cells via targeting microRNA-93-5p. Biosci Rep 2020; 40: BSR20194427. LiJ ZhaoQ JinX LiY SongJ Silencing of LncRNA PVT1 inhibits the proliferation, migration and fibrosis of high glucose-induced mouse mesangial cells via targeting microRNA-93-5p Biosci Rep 2020 40 BSR20194427 10.1042/BSR20194427719945332329508 Search in Google Scholar

Zhu B, Cheng X, Jiang Y, Cheng M, Chen L, Bao J, et al. Silencing of KCNQ1OT1 decreases oxidative stress and pyroptosis of renal tubular epithelial cells. Diabetes Metab Syndr Obes 2020; 13: 365–75. ZhuB ChengX JiangY ChengM ChenL BaoJ Silencing of KCNQ1OT1 decreases oxidative stress and pyroptosis of renal tubular epithelial cells Diabetes Metab Syndr Obes 2020 13 365 75 10.2147/DMSO.S225791702568232104033 Search in Google Scholar

Ge X, Xu B, Xu W, Xia L, Xu Z, Shen L, et al. Long noncoding RNA GAS5 inhibits cell proliferation and fibrosis in diabetic nephropathy by sponging miR-221 and modulating SIRT1 expression. Aging (Albany NY) 2019; 11: 8745–59. GeX XuB XuW XiaL XuZ ShenL Long noncoding RNA GAS5 inhibits cell proliferation and fibrosis in diabetic nephropathy by sponging miR-221 and modulating SIRT1 expression Aging (Albany NY) 2019 11 8745 59 10.18632/aging.102249683439831631065 Search in Google Scholar

Recommended articles from Trend MD

Plan your remote conference with Sciendo